ID: 1003313522

View in Genome Browser
Species Human (GRCh38)
Location 6:4990046-4990068
Sequence TAAGTGTGATGTTAGCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003313514_1003313522 27 Left 1003313514 6:4989996-4990018 CCTGATTTGTTCCTGACGTTGGG No data
Right 1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG No data
1003313512_1003313522 28 Left 1003313512 6:4989995-4990017 CCCTGATTTGTTCCTGACGTTGG No data
Right 1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG No data
1003313520_1003313522 16 Left 1003313520 6:4990007-4990029 CCTGACGTTGGGAAGGTGGGGAA No data
Right 1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003313522 Original CRISPR TAAGTGTGATGTTAGCTGTA GGG Intergenic
No off target data available for this crispr