ID: 1003314910

View in Genome Browser
Species Human (GRCh38)
Location 6:5003628-5003650
Sequence GTCTGGAGGGAGCTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003314910_1003314916 -1 Left 1003314910 6:5003628-5003650 CCTGACAACAGCTCCCTCCAGAC 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1003314916 6:5003650-5003672 CTGGGTACCGCCCCCACGCCCGG 0: 1
1: 0
2: 1
3: 30
4: 993
1003314910_1003314921 10 Left 1003314910 6:5003628-5003650 CCTGACAACAGCTCCCTCCAGAC 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1003314921 6:5003661-5003683 CCCCACGCCCGGCGCATCCTGGG 0: 1
1: 0
2: 0
3: 33
4: 231
1003314910_1003314919 9 Left 1003314910 6:5003628-5003650 CCTGACAACAGCTCCCTCCAGAC 0: 1
1: 0
2: 0
3: 14
4: 203
Right 1003314919 6:5003660-5003682 CCCCCACGCCCGGCGCATCCTGG 0: 1
1: 0
2: 2
3: 27
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003314910 Original CRISPR GTCTGGAGGGAGCTGTTGTC AGG (reversed) Intronic
900379716 1:2377812-2377834 GCCTCGAGGGTGCTGTGGTCTGG + Intronic
901392885 1:8958643-8958665 GCCTGGAGGGAGGTGTGGTCGGG + Intronic
901654428 1:10761282-10761304 GTCTGGAGGGAGCAGGCGTTGGG - Intronic
901684709 1:10937482-10937504 GTGAGGAGGGAGCTGCTGCCTGG + Intergenic
902704219 1:18193255-18193277 GTGTGGCTGGAGCTGTGGTCAGG + Intronic
903115501 1:21176190-21176212 GTCTGGAGGGCCCTGATGTTCGG + Exonic
904005324 1:27360503-27360525 GTCTGGAGGGTCCTGTGGGCAGG - Intronic
904340655 1:29832217-29832239 GTCTGGTGGGAGATGGTTTCAGG + Intergenic
904433529 1:30479732-30479754 GCCTGTAGGGAGCTGGTGTAGGG - Intergenic
906672418 1:47666030-47666052 GTCTGGAGGGAAGAGATGTCAGG - Intergenic
908121248 1:60988202-60988224 AACTGGAGGGAGCTGGTGTTTGG - Intronic
908925363 1:69248153-69248175 GTCTGAAAGGAGCTGTTGCTGGG - Intergenic
912151134 1:106860137-106860159 TTCTGGAGGGACCTGGTGGCAGG - Intergenic
913082699 1:115403553-115403575 GTCTGGAGGGAGATTTCCTCTGG - Intergenic
913256426 1:116958262-116958284 GCCTGCAGGGAGCTGTCTTCTGG + Intronic
913682306 1:121198008-121198030 GTGTGGAGAGAGCTATTGCCTGG + Intronic
914034143 1:143985629-143985651 GTGTGGAGAGAGCTATTGCCTGG + Intergenic
914155305 1:145082341-145082363 GTGTGGAGAGAGCTATTGCCTGG - Intronic
915216246 1:154342588-154342610 GTCAGGAGTGATGTGTTGTCTGG + Intronic
915798868 1:158766868-158766890 GTCTGAAGGAGGCTGTTGACAGG - Intergenic
920469619 1:206216519-206216541 GTGTGGAGAGAGCTATTGCCTGG + Intronic
920652066 1:207845256-207845278 TCCTGGAGGGAGCTGTCGCCCGG - Intergenic
921933110 1:220771372-220771394 GCCTGGAGGCATCTGTTGTTTGG - Intronic
924940727 1:248811225-248811247 GCCTGCAGGAAGCTGGTGTCAGG - Exonic
1063199631 10:3775538-3775560 GTTTGGAGGGAGCTGTGGTAGGG - Intergenic
1063427175 10:5959634-5959656 GTGTGGAAGGGGCTGCTGTCAGG + Intronic
1065266735 10:23984130-23984152 GTGTGGTGGGAGCTGCTTTCTGG - Intronic
1065925198 10:30428947-30428969 CTCTGGAGGGGGGTGTTGTCTGG + Intergenic
1066119168 10:32267261-32267283 GGCTGGAGGGAGCTGGGGTAGGG - Intergenic
1066316812 10:34255616-34255638 ATCTGGAGGGAACTGTTTCCAGG + Intronic
1069966222 10:72119460-72119482 GACTGGAGGGAGCTGAGGTGGGG - Intronic
1070442721 10:76462735-76462757 AGCTGGAGAGGGCTGTTGTCTGG - Intronic
1070506506 10:77118155-77118177 GTCTTTAGGGAGATTTTGTCTGG - Intronic
1071148820 10:82608691-82608713 GGCTGGAGGGAGCTGGAGTTGGG + Intronic
1073382575 10:103090946-103090968 CTCTGGATGGAACTGATGTCTGG + Exonic
1074234985 10:111576194-111576216 GTCTAGAAGCAGCTCTTGTCAGG + Intergenic
1075684281 10:124353227-124353249 GGCGGGAGGGAGCTGGGGTCGGG - Intergenic
1075835607 10:125450185-125450207 CTCTGGAGGGAGTTTTTTTCTGG - Intergenic
1076581431 10:131514589-131514611 GTCTGGCTGGAGCTGTGGTCAGG + Intergenic
1076761872 10:132610109-132610131 GTTTGTTGGGAGCTGTTGCCGGG - Intronic
1079441691 11:20521228-20521250 CTCTGGAGGAAGAGGTTGTCAGG - Intergenic
1082795773 11:57376810-57376832 GACGGGAGGGAGCTGCTGGCAGG + Exonic
1083181444 11:60988496-60988518 GTGAGGAGGGGGCTGTTGTTAGG + Intronic
1083766175 11:64842644-64842666 GTCTGGACGAAGCTTTTGTCTGG + Intronic
1087735472 11:101827812-101827834 GCCTGGAGGGAGCTGCTGCTGGG - Intronic
1088653528 11:111977852-111977874 GGCTGGAGGATGCTGTTGGCCGG + Intronic
1089683453 11:120132349-120132371 GTCAGGAGGGAGGTGTGGGCAGG - Intronic
1090880148 11:130825948-130825970 GTTTGGAGGGAGAGGCTGTCTGG - Intergenic
1092160935 12:6315140-6315162 TCCTGGAGGGAGCTGGTGCCTGG + Exonic
1092887764 12:12940228-12940250 GGCTGGAGGGAGCTGTTCAATGG + Intergenic
1101482181 12:105108251-105108273 CTCTGGAGGACGCTGATGTCTGG + Intronic
1102436646 12:112929360-112929382 CCCTGGAGAGAACTGTTGTCAGG - Intronic
1102768618 12:115453681-115453703 GTGTGGGGGGAAGTGTTGTCTGG - Intergenic
1103926214 12:124424759-124424781 CTTTGGAGGAAGCTCTTGTCCGG + Intronic
1104067585 12:125318243-125318265 GTCAGGAGGGAACTGTGGTTGGG + Intronic
1104074662 12:125378443-125378465 GGGTGGAGGTAGCTGTTCTCTGG + Intronic
1106498667 13:30306981-30307003 GTCTTGAGGGGGCTGTTGAGTGG - Intronic
1108718306 13:53104325-53104347 TTCTGGAGGTTGCTGTTGGCTGG + Intergenic
1114225333 14:20732742-20732764 GTCTGTAGGGAGCTGTTATTAGG + Intronic
1114226850 14:20746346-20746368 GTCTGTAGGGAGCTGTGATTAGG + Intronic
1114821763 14:26029100-26029122 GTCTGGTAGGAGCTATTGACTGG - Intergenic
1114988948 14:28263656-28263678 GTTTGGAGGGAGATGGTTTCGGG + Intergenic
1115919186 14:38354026-38354048 ATCTGGAGGGAGATGTTTTAAGG - Intergenic
1118344591 14:64928308-64928330 GGCTGCAGGGAGCTGTGATCAGG - Intronic
1119548668 14:75492368-75492390 GTGGAGAGGGAGCTGTAGTCAGG - Intergenic
1121012413 14:90528243-90528265 GCCTGGAGGAAGCTGGAGTCTGG + Exonic
1121456420 14:94041636-94041658 GTGTGGAGGGCGTTGGTGTCAGG - Intronic
1122280088 14:100616877-100616899 GTCTGGGGGAAGCTTTTGACTGG + Intergenic
1122339800 14:101020506-101020528 GTCTGGATGGAGTAGTGGTCTGG - Intergenic
1122508858 14:102249975-102249997 ATCTGGAGGGGGCAGATGTCAGG - Intronic
1122599749 14:102915391-102915413 GTATGGAGGGAAATGTTGTCAGG - Intergenic
1122684660 14:103495948-103495970 GTCTGGAGAGGGCTGCAGTCAGG + Intronic
1122820383 14:104341781-104341803 GGCTGGAGGGAGCTTGTTTCCGG - Intergenic
1124694302 15:31850953-31850975 GTGGGGTGGGAGCTGTTGTCTGG - Intronic
1124721297 15:32113160-32113182 GTCTGAATGAAGGTGTTGTCAGG + Intronic
1125360344 15:38858053-38858075 CTCTGGAGCCACCTGTTGTCAGG + Intergenic
1130666292 15:85872533-85872555 GGCTGGAATGAGCTGTTTTCAGG + Intergenic
1132861419 16:2073574-2073596 CCCTGTAGGGAGCTGTTGTTGGG + Intronic
1138529635 16:57628129-57628151 GTCGGGAGGGAGCGGGTGACAGG - Intronic
1139356020 16:66367394-66367416 GTGTCAAGGGAGCTGTAGTCTGG + Intronic
1142005967 16:87689774-87689796 CTCTGCAGGGGGCTGTCGTCGGG - Exonic
1142137548 16:88458614-88458636 TCCTGGAGGCAGCTGTTGCCTGG + Intronic
1143888826 17:10086853-10086875 TACTGGAGGGAGCTGAGGTCAGG + Intronic
1144185205 17:12790004-12790026 GCCTGGAGGGAGCTGGTGCAGGG - Intronic
1144598222 17:16589311-16589333 CTGTGGAGGGAGCTGTTCCCCGG - Intergenic
1147326384 17:39671691-39671713 TTCTGGAGGGCACTGTTGTGTGG + Exonic
1148839333 17:50484594-50484616 GTCTGTGGAGAGCTGTAGTCAGG - Intronic
1150292717 17:63990808-63990830 GTCTGGGCGGAGCTGCTGTGGGG - Intergenic
1150357210 17:64496910-64496932 GTCTGCAGGTGCCTGTTGTCTGG - Exonic
1151032397 17:70756366-70756388 TTCGGGATGGAGCTGTTGCCAGG + Intergenic
1152200878 17:78945221-78945243 GACTCGAGGGAGGTGGTGTCGGG - Intergenic
1152239246 17:79152961-79152983 GTCTGGAGGTGGCTGCGGTCGGG + Intronic
1152472814 17:80499818-80499840 GTCTGGGGGGAGTTGTGGGCTGG + Intergenic
1152590278 17:81208355-81208377 GCCTGGTGGGAGGTGGTGTCAGG + Intronic
1153512720 18:5873056-5873078 GGGTGGAGGCAGCTGTTGTGAGG - Intergenic
1153549150 18:6242517-6242539 GTTTGGAGGAAGCTGGTGACAGG - Intronic
1153632994 18:7089600-7089622 GGCTGGAGGCAGCTGCTGCCAGG - Intronic
1157287845 18:46389537-46389559 GTCTAGAGTTTGCTGTTGTCAGG + Intronic
1158020295 18:52833721-52833743 GGCTGCAGTGAGCTCTTGTCAGG - Intronic
1158165225 18:54532405-54532427 ATCTGGAGGAAGCTGCAGTCAGG - Intergenic
1160215645 18:76927358-76927380 GTCTGGAGAGAGCTGTTCTGTGG - Exonic
1160375419 18:78407715-78407737 GTCTAAAAGGAGCTGTTGGCAGG + Intergenic
1162849480 19:13419612-13419634 GGCTGCAGTGAGCTGTTATCAGG + Intronic
1164636532 19:29795632-29795654 GGCAGGAGAGACCTGTTGTCAGG - Intergenic
1164665872 19:30036398-30036420 GACTAGAGGGAGCTGGTGTTTGG + Intergenic
1165059823 19:33199684-33199706 GTTTGGAGGCACCCGTTGTCAGG + Intronic
1165735535 19:38173338-38173360 GTCTGGAGGGAGCATCTGTGAGG - Intronic
1166759141 19:45213532-45213554 TTCTGGAGGGAGCTGGTATGAGG - Intronic
1166897416 19:46032694-46032716 GTCTGGAGGGGGCTGTGGCAGGG - Intergenic
1167743962 19:51340298-51340320 GTCTGGAGGGAGGAGGGGTCGGG + Exonic
1168682622 19:58327022-58327044 GTGTGCTGGGAGCTGTGGTCCGG + Exonic
925024920 2:600018-600040 CTCTGAATGGAGCTGATGTCTGG - Intergenic
925881803 2:8358925-8358947 GGCTGCAGGGAGCTGTGATCAGG + Intergenic
927651000 2:24913698-24913720 GGCTGGAGGGAGCTGCCGTAGGG - Intronic
928772537 2:34719641-34719663 GTCTTGATGCAGCTGCTGTCGGG + Intergenic
930275878 2:49310549-49310571 AACTGGAGGGAGGTGTTGTAGGG + Intergenic
930353681 2:50290666-50290688 GACTGGAGGGGGCTGTTCTGTGG + Intronic
935977707 2:108595387-108595409 GTCTGGGTGGAGCTGAGGTCTGG - Intronic
937370893 2:121296480-121296502 GTCTGGAGGGGGCTGAGGTGAGG + Intergenic
942384565 2:175428113-175428135 TTCTGGAGGAATCTTTTGTCAGG - Intergenic
947819661 2:233061048-233061070 CCCTGGAGGAAGCTGTTGTTTGG + Intronic
947871592 2:233441661-233441683 GGCTGGTGGGAGCAGTTGGCTGG + Intronic
948129057 2:235586800-235586822 GACAGGAGGGAGCGGTTGGCTGG + Intronic
1170280138 20:14637091-14637113 GACTGGAGGGAGCTGGTGGGAGG + Intronic
1172162817 20:32880121-32880143 GTCAGGAGGGAGCTGTGGGTGGG + Intronic
1174395152 20:50242745-50242767 GTCAGGAGGGACCTGTGGACGGG + Intergenic
1175548793 20:59802192-59802214 TTCAGGAGGGAGGTGGTGTCTGG + Intronic
1175953640 20:62596840-62596862 GGCTGGAGGGACCTGTTGCTGGG - Intergenic
1178707401 21:34887138-34887160 GTCTGGTAGGAGCTGTTTGCAGG - Intronic
1178734378 21:35135686-35135708 GGCCGGGGGGAGCTGTGGTCTGG + Intronic
1179975794 21:44865283-44865305 GTGTGGAGGGCTCTGTTGTTTGG - Intronic
1182799983 22:33024186-33024208 GTCTGGAGGGTGCTGGTGGGTGG - Intronic
1183028522 22:35084524-35084546 GGGTGGAGGGAGCCATTGTCTGG + Intronic
1183722792 22:39572167-39572189 GTCTGGAGAGATCTGTGCTCTGG + Intronic
1183829750 22:40411499-40411521 GACTGGCTGGAGCTGTCGTCAGG - Exonic
1184534212 22:45075729-45075751 GTCTGGGGCGAGATGTTGTTAGG - Intergenic
1184687986 22:46104994-46105016 GTGGGGAGGGAGATGCTGTCTGG - Intronic
1185017604 22:48353759-48353781 GTCTGGAGGCCCCTGGTGTCTGG - Intergenic
1185118260 22:48950298-48950320 GTCTCAAGGGAGCCGTGGTCAGG - Intergenic
1185134878 22:49063782-49063804 GTGGGGAGGGAGCTGCTCTCAGG + Intergenic
1185324524 22:50219212-50219234 GGCAGGAGGGAGCTGGAGTCAGG + Intronic
949517608 3:4821425-4821447 GTCTGCAAGGAGCTGCTCTCAGG - Intronic
951411632 3:22373085-22373107 GTGTGGGGGAAGTTGTTGTCTGG - Intronic
952395095 3:32914209-32914231 TCCTGGAGGGAGATGTTTTCAGG - Intergenic
953494229 3:43372505-43372527 GGGTGGAGGGAGCTGGTGGCTGG - Intronic
954798027 3:53171452-53171474 GGCTGCAGGGACCTGTTGGCTGG - Intronic
954810164 3:53242600-53242622 GGCTGGGGGCAGCTGCTGTCAGG + Intronic
959300806 3:104598491-104598513 GGCTGTAGGGAGTAGTTGTCTGG - Intergenic
961563879 3:127749756-127749778 GTCTGGAGGGAGCGGGTATGTGG + Intronic
963258952 3:143175204-143175226 GTCTGGTGGGAGCTGAAGTCAGG + Intergenic
964431394 3:156610332-156610354 GTCTGGAGGTTGATGATGTCGGG + Intergenic
964922236 3:161911352-161911374 GTCTGGAGGTAGGTGGTCTCTGG - Intergenic
968377268 4:53778-53800 GCCTGGGAGGAGCTGTGGTCCGG + Intronic
968401841 4:304993-305015 GCCTGGGAGGAGCTGTGGTCCGG - Intronic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
969290273 4:6234523-6234545 GTCTGGAGGGCGGTGCTGTGTGG + Intergenic
972780165 4:42280148-42280170 GACTGGAAGGAGCTGTGGTCTGG - Intergenic
974142719 4:57908354-57908376 GTGTGGAGGGAGATGGTTTCAGG + Intergenic
975241832 4:72068263-72068285 GTCTGGTGAGGGCTGTTCTCTGG + Intronic
977616391 4:99091380-99091402 GTCTAGAGGGAGCTGGAGTTGGG - Intergenic
982799033 4:159679937-159679959 GTCTAGAGGGAGCTGGAGTTGGG - Intergenic
983077006 4:163338416-163338438 CTCTGAAGGGAGCTGTGGTTTGG - Intronic
984726105 4:183022796-183022818 TTTTGGAGGGAGCTGCTATCCGG + Intergenic
984836487 4:184026947-184026969 GGCTGGAGGTAGTGGTTGTCAGG + Intergenic
986152989 5:5144872-5144894 GTCTGGAGCAAGCTGCAGTCAGG + Intronic
989162389 5:38404030-38404052 GGGTGGAGTGAGCTGTTCTCAGG - Intronic
998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG + Intronic
999258664 5:150224116-150224138 ATCTGGTGGAAGCTGGTGTCAGG - Intronic
1001825971 5:174745335-174745357 GTCTGGTGAGGGCTGTTATCTGG + Intergenic
1002194649 5:177495380-177495402 GTGGGCAGGCAGCTGTTGTCAGG - Intronic
1002644717 5:180647564-180647586 GTCCGGTGGGAGCTGCAGTCGGG - Intronic
1003314910 6:5003628-5003650 GTCTGGAGGGAGCTGTTGTCAGG - Intronic
1004433703 6:15569456-15569478 GTTTGGAGTGGGCTGATGTCTGG - Intronic
1004936210 6:20510855-20510877 GGCTGCAGTGAGCTGTGGTCAGG + Intergenic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1013236787 6:108203917-108203939 GTCTGCAGGCAGCAGCTGTCAGG + Intergenic
1014059065 6:117050040-117050062 ATCTTGAAGGAGCTGCTGTCAGG - Intergenic
1014282807 6:119460726-119460748 CTCTGGACAGAGCTCTTGTCTGG + Intergenic
1016327175 6:142915817-142915839 GTCTGGAGGAAGGGGTGGTCTGG - Intronic
1017204687 6:151791948-151791970 GTTTGGAGGAAGGTGTTGTTAGG + Intronic
1017798846 6:157873796-157873818 GTCTTGGGGGAGCTGCTGTGGGG + Intronic
1018256271 6:161923004-161923026 GCCTGGAGGGAGCTGTGACCTGG - Intronic
1019035066 6:169047634-169047656 GTTTGGAGGGAGCAGTTGCGGGG + Intergenic
1019274719 7:169966-169988 GGCTGGAGGGAGCTGAGGTCGGG - Intergenic
1022050183 7:26659608-26659630 ATTTGCAGGGAGCTGTTTTCTGG + Intergenic
1023624685 7:42104335-42104357 GGCTGGAGGGTGCAGATGTCAGG - Intronic
1024465681 7:49709628-49709650 GTCTGGAGTGAGATGGTGACTGG - Intergenic
1024917226 7:54515230-54515252 GTCTTGATGCAGCTGCTGTCAGG + Intergenic
1031966979 7:128033379-128033401 GTCTGGAGGCAGCTCTTGAAGGG - Intronic
1032424191 7:131807332-131807354 GTCTGGCGGGAGCTGAGATCAGG + Intergenic
1032551556 7:132789054-132789076 GGCTGGAGGGATCCGTAGTCTGG + Intronic
1034002660 7:147432792-147432814 CTCTGTAGGGAGGTGATGTCTGG - Intronic
1035394711 7:158527333-158527355 GTCTTCAGGGAGCTGTGGCCAGG - Intronic
1035583706 8:756185-756207 GTCTGGGAGGAGCTGGCGTCTGG + Intergenic
1035616350 8:1004901-1004923 GGCAGGAGGGGGCTGCTGTCCGG + Intergenic
1038928234 8:32164379-32164401 GTCAGGAGGCAGCTATTGGCTGG - Intronic
1041724527 8:61005620-61005642 GTATGGACGGAGCAGATGTCAGG + Intergenic
1043698394 8:83251460-83251482 GTCTGGGGGAAGCTGTAGTGTGG + Intergenic
1049298164 8:141854873-141854895 GTGGGGAGGAAGGTGTTGTCTGG + Intergenic
1049543681 8:143219839-143219861 GTCAGGAGGGAGGTGTGGTTAGG - Intergenic
1049687278 8:143944045-143944067 GGCGGGCGGGAGCTGTTGTGGGG - Intronic
1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG + Intergenic
1055600957 9:77918011-77918033 GGCCGGAGGGTGCTGTGGTCAGG - Intronic
1056062859 9:82902037-82902059 GTCAGGAGAGAGTTGATGTCTGG + Intergenic
1056708108 9:88968866-88968888 GTCTGGAAGGAGCTGCAGTAAGG + Intergenic
1057785848 9:98086966-98086988 TTCTGGAGGGAGCTGTGATGTGG + Exonic
1059382024 9:113934200-113934222 GGCTGGTGGGAGGGGTTGTCTGG + Intronic
1060057909 9:120431606-120431628 GTCTGGAGGGGGCCTTTGCCAGG - Intronic
1061088828 9:128415047-128415069 CTCTGAAGGGAGTTATTGTCAGG + Intronic
1061353462 9:130084882-130084904 CTCTGGAAGGAGCTGTCGCCGGG + Intronic
1061748329 9:132756331-132756353 GTCTGGGGAAAGCTGCTGTCGGG + Intronic
1062090004 9:134670953-134670975 GCCGGGAGGGAGCTGATGTCTGG + Intronic
1062184801 9:135212373-135212395 GGCTGGACGTAGCTGCTGTCGGG - Intergenic
1203563905 Un_KI270744v1:77715-77737 TTCAGGAGGGAGCTGTGGGCCGG - Intergenic
1203571968 Un_KI270744v1:140468-140490 GCCTGGGAGGAGCTGTGGTCCGG - Intergenic
1186787575 X:12968075-12968097 GTCGGGAGGGTGCTGGTTTCAGG - Intergenic
1190997470 X:55624195-55624217 GACTGGAGGGAGTTGTCGTCTGG - Exonic
1193833619 X:86316654-86316676 TGCTGGAGGGAGGTGTTGTGTGG + Intronic