ID: 1003317841

View in Genome Browser
Species Human (GRCh38)
Location 6:5027776-5027798
Sequence GGCCCCTCCTGAAAACTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317841_1003317847 -1 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317847 6:5027798-5027820 CCTGGAGACAACAGGACCGGTGG No data
1003317841_1003317849 22 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317849 6:5027821-5027843 CACCGCAGCCTTTCCCTTTCAGG No data
1003317841_1003317850 23 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317850 6:5027822-5027844 ACCGCAGCCTTTCCCTTTCAGGG No data
1003317841_1003317843 -9 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317843 6:5027790-5027812 GGAGGGGCCCTGGAGACAACAGG No data
1003317841_1003317844 -4 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317844 6:5027795-5027817 GGCCCTGGAGACAACAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317841 Original CRISPR GGCCCCTCCTGAAAACTCCA TGG (reversed) Intergenic