ID: 1003317845

View in Genome Browser
Species Human (GRCh38)
Location 6:5027797-5027819
Sequence CACCGGTCCTGTTGTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317845_1003317855 18 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317855 6:5027838-5027860 TTCAGGGTGCTTAAGTGCCCCGG No data
1003317845_1003317857 23 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317845_1003317859 29 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317859 6:5027849-5027871 TAAGTGCCCCGGGCTGGTGGAGG No data
1003317845_1003317850 2 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317850 6:5027822-5027844 ACCGCAGCCTTTCCCTTTCAGGG No data
1003317845_1003317858 26 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317845_1003317860 30 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG No data
1003317845_1003317856 19 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317856 6:5027839-5027861 TCAGGGTGCTTAAGTGCCCCGGG No data
1003317845_1003317849 1 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317849 6:5027821-5027843 CACCGCAGCCTTTCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317845 Original CRISPR CACCGGTCCTGTTGTCTCCA GGG (reversed) Intergenic