ID: 1003317848

View in Genome Browser
Species Human (GRCh38)
Location 6:5027814-5027836
Sequence GGGAAAGGCTGCGGTGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317848_1003317866 24 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317866 6:5027861-5027883 GCTGGTGGAGGGCTGGGCACAGG No data
1003317848_1003317858 9 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317848_1003317863 18 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317863 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
1003317848_1003317861 17 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317848_1003317860 13 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG No data
1003317848_1003317856 2 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317856 6:5027839-5027861 TCAGGGTGCTTAAGTGCCCCGGG No data
1003317848_1003317855 1 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317855 6:5027838-5027860 TTCAGGGTGCTTAAGTGCCCCGG No data
1003317848_1003317859 12 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317859 6:5027849-5027871 TAAGTGCCCCGGGCTGGTGGAGG No data
1003317848_1003317857 6 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317848 Original CRISPR GGGAAAGGCTGCGGTGCCAC CGG (reversed) Intergenic