ID: 1003317849

View in Genome Browser
Species Human (GRCh38)
Location 6:5027821-5027843
Sequence CACCGCAGCCTTTCCCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317845_1003317849 1 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317849 6:5027821-5027843 CACCGCAGCCTTTCCCTTTCAGG No data
1003317841_1003317849 22 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317849 6:5027821-5027843 CACCGCAGCCTTTCCCTTTCAGG No data
1003317846_1003317849 0 Left 1003317846 6:5027798-5027820 CCTGGAGACAACAGGACCGGTGG No data
Right 1003317849 6:5027821-5027843 CACCGCAGCCTTTCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317849 Original CRISPR CACCGCAGCCTTTCCCTTTC AGG Intergenic