ID: 1003317850

View in Genome Browser
Species Human (GRCh38)
Location 6:5027822-5027844
Sequence ACCGCAGCCTTTCCCTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317841_1003317850 23 Left 1003317841 6:5027776-5027798 CCATGGAGTTTTCAGGAGGGGCC No data
Right 1003317850 6:5027822-5027844 ACCGCAGCCTTTCCCTTTCAGGG No data
1003317845_1003317850 2 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317850 6:5027822-5027844 ACCGCAGCCTTTCCCTTTCAGGG No data
1003317846_1003317850 1 Left 1003317846 6:5027798-5027820 CCTGGAGACAACAGGACCGGTGG No data
Right 1003317850 6:5027822-5027844 ACCGCAGCCTTTCCCTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317850 Original CRISPR ACCGCAGCCTTTCCCTTTCA GGG Intergenic