ID: 1003317851

View in Genome Browser
Species Human (GRCh38)
Location 6:5027823-5027845
Sequence ACCCTGAAAGGGAAAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317851_1003317861 8 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317851_1003317855 -8 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317855 6:5027838-5027860 TTCAGGGTGCTTAAGTGCCCCGG No data
1003317851_1003317856 -7 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317856 6:5027839-5027861 TCAGGGTGCTTAAGTGCCCCGGG No data
1003317851_1003317863 9 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317863 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
1003317851_1003317866 15 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317866 6:5027861-5027883 GCTGGTGGAGGGCTGGGCACAGG No data
1003317851_1003317857 -3 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317851_1003317860 4 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 199
1003317851_1003317859 3 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317859 6:5027849-5027871 TAAGTGCCCCGGGCTGGTGGAGG No data
1003317851_1003317868 29 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317851_1003317867 22 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317851_1003317858 0 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317851 Original CRISPR ACCCTGAAAGGGAAAGGCTG CGG (reversed) Intergenic