ID: 1003317852

View in Genome Browser
Species Human (GRCh38)
Location 6:5027829-5027851
Sequence TTAAGCACCCTGAAAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317852_1003317857 -9 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317852_1003317863 3 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317863 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
1003317852_1003317868 23 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317852_1003317858 -6 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317852_1003317859 -3 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317859 6:5027849-5027871 TAAGTGCCCCGGGCTGGTGGAGG No data
1003317852_1003317861 2 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317852_1003317867 16 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317852_1003317860 -2 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG No data
1003317852_1003317866 9 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317866 6:5027861-5027883 GCTGGTGGAGGGCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317852 Original CRISPR TTAAGCACCCTGAAAGGGAA AGG (reversed) Intergenic