ID: 1003317854

View in Genome Browser
Species Human (GRCh38)
Location 6:5027835-5027857
Sequence GGGCACTTAAGCACCCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317854_1003317867 10 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317854_1003317866 3 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317866 6:5027861-5027883 GCTGGTGGAGGGCTGGGCACAGG No data
1003317854_1003317868 17 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317854_1003317860 -8 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317860 6:5027850-5027872 AAGTGCCCCGGGCTGGTGGAGGG No data
1003317854_1003317859 -9 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317859 6:5027849-5027871 TAAGTGCCCCGGGCTGGTGGAGG No data
1003317854_1003317863 -3 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317863 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
1003317854_1003317861 -4 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317854 Original CRISPR GGGCACTTAAGCACCCTGAA AGG (reversed) Intergenic