ID: 1003317857

View in Genome Browser
Species Human (GRCh38)
Location 6:5027843-5027865
Sequence GGTGCTTAAGTGCCCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317851_1003317857 -3 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317846_1003317857 22 Left 1003317846 6:5027798-5027820 CCTGGAGACAACAGGACCGGTGG No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317848_1003317857 6 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317845_1003317857 23 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data
1003317852_1003317857 -9 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317857 6:5027843-5027865 GGTGCTTAAGTGCCCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317857 Original CRISPR GGTGCTTAAGTGCCCCGGGC TGG Intergenic