ID: 1003317858

View in Genome Browser
Species Human (GRCh38)
Location 6:5027846-5027868
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317851_1003317858 0 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317845_1003317858 26 Left 1003317845 6:5027797-5027819 CCCTGGAGACAACAGGACCGGTG No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317852_1003317858 -6 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317848_1003317858 9 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data
1003317846_1003317858 25 Left 1003317846 6:5027798-5027820 CCTGGAGACAACAGGACCGGTGG No data
Right 1003317858 6:5027846-5027868 GCTTAAGTGCCCCGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317858 Original CRISPR GCTTAAGTGCCCCGGGCTGG TGG Intergenic
No off target data available for this crispr