ID: 1003317861

View in Genome Browser
Species Human (GRCh38)
Location 6:5027854-5027876
Sequence GCCCCGGGCTGGTGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317852_1003317861 2 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317848_1003317861 17 Left 1003317848 6:5027814-5027836 CCGGTGGCACCGCAGCCTTTCCC No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317851_1003317861 8 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317853_1003317861 -3 Left 1003317853 6:5027834-5027856 CCCTTTCAGGGTGCTTAAGTGCC No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data
1003317854_1003317861 -4 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317861 6:5027854-5027876 GCCCCGGGCTGGTGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317861 Original CRISPR GCCCCGGGCTGGTGGAGGGC TGG Intergenic