ID: 1003317867

View in Genome Browser
Species Human (GRCh38)
Location 6:5027868-5027890
Sequence GAGGGCTGGGCACAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317854_1003317867 10 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317852_1003317867 16 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317862_1003317867 -10 Left 1003317862 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317851_1003317867 22 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data
1003317853_1003317867 11 Left 1003317853 6:5027834-5027856 CCCTTTCAGGGTGCTTAAGTGCC No data
Right 1003317867 6:5027868-5027890 GAGGGCTGGGCACAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317867 Original CRISPR GAGGGCTGGGCACAGGAGAG AGG Intergenic