ID: 1003317868

View in Genome Browser
Species Human (GRCh38)
Location 6:5027875-5027897
Sequence GGGCACAGGAGAGAGGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003317852_1003317868 23 Left 1003317852 6:5027829-5027851 CCTTTCCCTTTCAGGGTGCTTAA No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317864_1003317868 -4 Left 1003317864 6:5027856-5027878 CCCGGGCTGGTGGAGGGCTGGGC No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317862_1003317868 -3 Left 1003317862 6:5027855-5027877 CCCCGGGCTGGTGGAGGGCTGGG No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317865_1003317868 -5 Left 1003317865 6:5027857-5027879 CCGGGCTGGTGGAGGGCTGGGCA No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317853_1003317868 18 Left 1003317853 6:5027834-5027856 CCCTTTCAGGGTGCTTAAGTGCC No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317851_1003317868 29 Left 1003317851 6:5027823-5027845 CCGCAGCCTTTCCCTTTCAGGGT No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data
1003317854_1003317868 17 Left 1003317854 6:5027835-5027857 CCTTTCAGGGTGCTTAAGTGCCC No data
Right 1003317868 6:5027875-5027897 GGGCACAGGAGAGAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003317868 Original CRISPR GGGCACAGGAGAGAGGCAAG TGG Intergenic