ID: 1003319629

View in Genome Browser
Species Human (GRCh38)
Location 6:5038849-5038871
Sequence CATCAGAGGGAGACCGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003319624_1003319629 -8 Left 1003319624 6:5038834-5038856 CCAGCCTTGGCTCGGCATCAGAG 0: 36
1: 231
2: 618
3: 475
4: 409
Right 1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG No data
1003319620_1003319629 13 Left 1003319620 6:5038813-5038835 CCGAGATGGCAGCAGCACCGTCC No data
Right 1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG No data
1003319623_1003319629 -4 Left 1003319623 6:5038830-5038852 CCGTCCAGCCTTGGCTCGGCATC 0: 21
1: 57
2: 62
3: 49
4: 155
Right 1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003319629 Original CRISPR CATCAGAGGGAGACCGCGGA AGG Intergenic
No off target data available for this crispr