ID: 1003329574

View in Genome Browser
Species Human (GRCh38)
Location 6:5118799-5118821
Sequence GGGTCGATATTCGTAAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003329574 Original CRISPR GGGTCGATATTCGTAAGTTT GGG (reversed) Intronic
907592472 1:55688496-55688518 GTGTCGATATTTGTAAAATTAGG - Intergenic
910344866 1:86225001-86225023 GGTTCCACATTTGTAAGTTTGGG - Intergenic
916238619 1:162615828-162615850 GGGTAGATACTTTTAAGTTTAGG + Intergenic
1084699747 11:70778772-70778794 GAGTCTATATTAGTCAGTTTGGG - Intronic
1098791552 12:74830351-74830373 GGGTCGATATTGGTCTGTTCAGG + Intergenic
1114704572 14:24712393-24712415 TGGTGGATATTTTTAAGTTTGGG - Intergenic
1116151504 14:41147224-41147246 GGGTAGATATGTATAAGTTTAGG - Intergenic
1136132141 16:28229738-28229760 GGGGCCATATGAGTAAGTTTTGG - Intergenic
1139927059 16:70495020-70495042 TGGTAGATATTAGCAAGTTTAGG + Intronic
933708541 2:85308815-85308837 GGGTGGATCTTCATCAGTTTGGG + Intronic
944338863 2:198571010-198571032 GTGTCCATATTCTTAAGGTTTGG + Intronic
983467030 4:168107553-168107575 GGTCCTATATTAGTAAGTTTAGG + Intronic
1003329574 6:5118799-5118821 GGGTCGATATTCGTAAGTTTGGG - Intronic
1021238930 7:18177164-18177186 GGGTCTATATAAGTAAGTTATGG + Intronic
1042791042 8:72606735-72606757 GGGTGGATATTCATTTGTTTGGG - Intronic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1193428011 X:81364136-81364158 GGTTCGATATTTGTAAGTCAGGG - Intergenic
1196427768 X:115589411-115589433 GGGACTATATTGGAAAGTTTAGG - Intronic
1198271120 X:135056896-135056918 GGGTCTATGTGCTTAAGTTTTGG + Intergenic