ID: 1003330058

View in Genome Browser
Species Human (GRCh38)
Location 6:5122280-5122302
Sequence CTAGAAGTTCCTGACTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003330054_1003330058 26 Left 1003330054 6:5122231-5122253 CCTGCTTGGTTGGACGGTACAGA 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 139
1003330055_1003330058 -6 Left 1003330055 6:5122263-5122285 CCCACACTAATCTGATTCTAGAA 0: 1
1: 0
2: 1
3: 9
4: 180
Right 1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 139
1003330056_1003330058 -7 Left 1003330056 6:5122264-5122286 CCACACTAATCTGATTCTAGAAG 0: 1
1: 0
2: 0
3: 5
4: 147
Right 1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 139
1003330053_1003330058 27 Left 1003330053 6:5122230-5122252 CCCTGCTTGGTTGGACGGTACAG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003330058 Original CRISPR CTAGAAGTTCCTGACTTTGT GGG Intronic
900261716 1:1734123-1734145 CTAGAAGTCTCTGAGTTTGAAGG - Intronic
902129743 1:14249445-14249467 CTGGAACTTCCTGATTTTGTGGG - Intergenic
902892847 1:19457045-19457067 CTGGAACTTCCTGCCTTTCTGGG - Intronic
907157659 1:52349222-52349244 GTAGAAGTTCCAGACTTTTGAGG - Intronic
908718344 1:67095239-67095261 TGAGAAGTTACTGTCTTTGTTGG + Exonic
909609960 1:77541213-77541235 CTAGGAGTTCTTGACTATCTTGG + Intronic
909631901 1:77776603-77776625 CTAGAAATGCCTAACTTTCTGGG - Intergenic
912235377 1:107844796-107844818 CTATAAGCCCCTGACTTTGGGGG - Intronic
913569620 1:120107197-120107219 TTAGAAGTTTGTGACTTTGGTGG + Intergenic
914290429 1:146268159-146268181 TTAGAAGTTTGTGACTTTGGTGG + Intergenic
914551473 1:148718942-148718964 TTAGAAGTTTGTGACTTTGGTGG + Intergenic
915586690 1:156847614-156847636 CGGGAAGTGCCTGCCTTTGTTGG + Intronic
917283728 1:173403433-173403455 CTAGAAGCTCCCTAATTTGTAGG + Intergenic
917494842 1:175530994-175531016 CAAGAAGCTCCTGTCTTTGAGGG + Intronic
921567950 1:216743012-216743034 CTAGAGGCTCCATACTTTGTTGG - Intronic
921771811 1:219049346-219049368 CTAGAAGTAACTGACTATTTTGG + Intergenic
923805788 1:237256473-237256495 CAAGAAGGTGATGACTTTGTAGG - Intronic
924106526 1:240654575-240654597 GTAGAAGTTCCTGGCGTTCTAGG - Intergenic
1063620741 10:7646215-7646237 CTAGAATATACTGAGTTTGTGGG - Intronic
1067751714 10:48976110-48976132 TTAGAAGTTCCTGAATTGTTAGG - Intronic
1070531990 10:77345096-77345118 CTAGAGGTTCCATGCTTTGTTGG + Intronic
1071038947 10:81283045-81283067 CTAGGAATTCCTCACTTTCTGGG + Intergenic
1073513736 10:104059067-104059089 TTAGCAGTTCCTGACATTTTAGG - Intronic
1078204509 11:9216532-9216554 CTATAAGTTCCTGAGCTTTTTGG - Intronic
1078630089 11:12994591-12994613 CTAGAATTTCCAGATTCTGTGGG - Intergenic
1078871657 11:15351012-15351034 CTAGAAATTCCTGCCTTCATGGG + Intergenic
1079012521 11:16841115-16841137 CTTGAAATTCCTGAGTCTGTTGG - Intronic
1083066325 11:59927616-59927638 CAAAAAGTAGCTGACTTTGTGGG + Intergenic
1087909232 11:103734104-103734126 TTGGAATTTCCTGAATTTGTGGG + Intergenic
1092293250 12:7177934-7177956 CTAGAAGTTTCTGTCTTGGTAGG + Intergenic
1093292333 12:17343186-17343208 CTAAAACTTCCTGAATTTGATGG - Intergenic
1094283589 12:28767618-28767640 CTAGAATTTCTTAACTCTGTTGG - Intergenic
1095270886 12:40217280-40217302 CTAGAAAGTCCTGAGTTTGATGG - Intronic
1096679946 12:53249018-53249040 CCAGAAGTTCAAGACTTTTTTGG + Intergenic
1097897114 12:64835831-64835853 CTAGAGGTTCTTGACATTTTAGG + Intronic
1098210841 12:68163618-68163640 CTAGAGGTTTCACACTTTGTTGG + Intergenic
1099922767 12:88979870-88979892 CTTGAAGTTGCAGATTTTGTAGG + Intergenic
1101602326 12:106221524-106221546 CTAGAACTTCTAGTCTTTGTGGG - Intergenic
1101627665 12:106461464-106461486 CCAGCAGTCCCTGTCTTTGTGGG + Intronic
1103697651 12:122829845-122829867 CTAGAACTTCTTGGCTGTGTGGG + Intergenic
1104632962 12:130419653-130419675 CTGGACTTTCCTCACTTTGTAGG + Intronic
1107930322 13:45301687-45301709 CTGGCAGCTCCTCACTTTGTAGG + Intergenic
1109071201 13:57771499-57771521 CTAAAAGATTCTGACTTTTTGGG - Intergenic
1110124342 13:71923735-71923757 CTGGAAGTTCTTCACTTTGAGGG + Intergenic
1114963696 14:27928778-27928800 CTAGGAATGCCTGACTTTCTGGG - Intergenic
1118452987 14:65920908-65920930 CCACAAGTTCCTGACTCTCTTGG + Intergenic
1118808019 14:69254599-69254621 CTAGAAGTGCCTGGCATGGTAGG + Intergenic
1120506585 14:85360338-85360360 GTAGAAGTTACTGACGTTATAGG - Intergenic
1121951704 14:98176537-98176559 GTAGCTGTTCCTGACTTTGGAGG - Intergenic
1202890281 14_KI270722v1_random:150176-150198 CTAGAACTTCATGTCTGTGTGGG + Intergenic
1124208821 15:27745490-27745512 CTAGAAATACCTAACTTTCTGGG + Intergenic
1125364661 15:38901187-38901209 GTGGAAATTCCCGACTTTGTAGG + Intergenic
1133590774 16:7240933-7240955 CAAAAAGTTTCTAACTTTGTTGG + Intronic
1135984189 16:27171997-27172019 ATAGAAGTTTTTGCCTTTGTAGG + Intergenic
1137248959 16:46729343-46729365 CAAGAAGGTCCTGTCCTTGTTGG - Intronic
1138270215 16:55690747-55690769 CTTGGAGTTTCTGACTTAGTTGG - Intronic
1138512472 16:57516534-57516556 CTAGAACTGCCTGACCTCGTGGG - Intronic
1140292223 16:73670385-73670407 GAAGCAGTTCCTAACTTTGTTGG + Intergenic
1140951269 16:79820111-79820133 TTTGAAGTTCCAGAGTTTGTTGG - Intergenic
1143106126 17:4531409-4531431 CTGGAATTTCCTGACGTGGTGGG - Intronic
1150761997 17:67970667-67970689 ATAAAAGTTGCTGATTTTGTTGG - Intronic
1156204372 18:34870279-34870301 CTACAATTTCCTGACTTAATTGG - Intronic
1158231410 18:55259870-55259892 CTTGTACTTCCTGATTTTGTAGG - Intronic
1158842756 18:61405755-61405777 CTAGAAGTTTCAGATTCTGTAGG - Intronic
1158960876 18:62586901-62586923 CTTGAAGGTCCTGATTTTCTGGG + Intronic
1161734860 19:5985551-5985573 ATAGAAATTCCTGAGTTTGCTGG - Intergenic
1162421414 19:10568106-10568128 CTAGGGGTTCCTCATTTTGTAGG - Intronic
1164546528 19:29169549-29169571 CTATAACTTTCTGAGTTTGTAGG + Intergenic
1202665701 1_KI270708v1_random:117004-117026 CTAGAACTTCATGTCTGTGTAGG + Intergenic
925860907 2:8174360-8174382 CTAAAAGTTTCTGTCTTTCTAGG - Intergenic
930916056 2:56689666-56689688 CTAGAACTGCATGAGTTTGTGGG + Intergenic
931488498 2:62718563-62718585 CTAGGAGGTCCTGATTCTGTAGG + Intronic
936134671 2:109879712-109879734 CTAGGAATTCCTCACTTTCTGGG - Intergenic
936210026 2:110491773-110491795 CTAGGAATTCCTCACTTTCTGGG + Intergenic
936429219 2:112447245-112447267 CTAGGAATTCCTCACTTTCTGGG + Intergenic
938796559 2:134722249-134722271 CTAGAAGCCACTGACTATGTGGG - Intergenic
940653319 2:156459140-156459162 CTAGAATTTCTTCACCTTGTAGG - Intronic
945681760 2:212922433-212922455 CAATCAGTTCCTGACTTTGTAGG + Intergenic
946452290 2:219790972-219790994 CTAGGAATTCCTTACTTTCTTGG - Intergenic
946831061 2:223728459-223728481 CTAGAAATCCCTCACTTTCTTGG - Intergenic
947028328 2:225763933-225763955 CTAGTAGTCCCTGACCTTGTAGG + Intergenic
1168794988 20:605447-605469 CTAGCACTTCCTGCCTTTCTGGG + Intronic
1170082309 20:12490600-12490622 CTAGAAGTTCCTTAATATGTAGG - Intergenic
1170361561 20:15552137-15552159 CTAGAAGTTCTTCTCTTTTTTGG + Intronic
1172798646 20:37560869-37560891 CTAGGAATGCCTGACTTTCTGGG - Intergenic
1179214976 21:39359670-39359692 CTAGAAATACCTGACTTTCTGGG - Intergenic
1180332415 22:11493929-11493951 CTAGAACTTCATGTCTGTGTAGG + Intergenic
1181387004 22:22553607-22553629 CAAGAGGATCCTGACTTTCTGGG - Intronic
1184951649 22:47847303-47847325 CTGGAAAGTCCTGACTTTCTGGG - Intergenic
949667291 3:6354691-6354713 CTCTAAGTTCCTTACTATGTGGG + Intergenic
951868104 3:27329874-27329896 CTATAATTTCATGACTTTTTTGG + Intronic
953200964 3:40778208-40778230 CTGGAAGTTTCTGCCTTTGTTGG - Intergenic
954995991 3:54882164-54882186 CTAGAATTTTCTGCCTCTGTGGG + Intronic
955238466 3:57160365-57160387 CTAGCAGTTCTTTCCTTTGTTGG + Intronic
955726058 3:61934048-61934070 CTACAATTTCCTCACTTTGTGGG + Intronic
958827883 3:99054062-99054084 ATAGAATTTCTGGACTTTGTTGG + Intergenic
961129366 3:124451557-124451579 CTATAAGTTACTGTCTTTGGAGG + Intronic
965122304 3:164576620-164576642 CTAAAAGTTGCTGACTCTCTAGG - Intergenic
969087232 4:4665599-4665621 CTAGAAGCTGGTGACTGTGTGGG + Intergenic
969947607 4:10800514-10800536 CTAGAAGTTACACACTTTATTGG - Intergenic
969964656 4:10981757-10981779 CTAGGAATGCCTGACTTTTTGGG + Intergenic
970016244 4:11515811-11515833 CGACAAGCTCCTAACTTTGTTGG + Intergenic
970083750 4:12321452-12321474 CTAGGTTTTCCTGAGTTTGTAGG + Intergenic
974574269 4:63697836-63697858 CTAGGAGTTCCTGACTTTCTGGG - Intergenic
974949533 4:68571269-68571291 CTAGAAGTTCATGTTTTTATGGG + Intronic
978931124 4:114313216-114313238 CTAGAAGTTCCTCTCCTTGTAGG + Intergenic
980539829 4:134178390-134178412 CTTGAAGTTACTGTCCTTGTGGG - Intergenic
980875911 4:138661934-138661956 CTAGCAGTACCTAACTTTCTGGG + Intergenic
983250416 4:165339065-165339087 ATAGAAGTTACTGTTTTTGTGGG - Intronic
984097657 4:175451732-175451754 CTAGGAATGCCTGACTTTCTGGG + Intergenic
991367003 5:65879112-65879134 CTAGAATTACCTGACTTGGTGGG - Intergenic
992548427 5:77838488-77838510 CATCAAGTTCCTGACTTTGCTGG - Intronic
994156686 5:96511569-96511591 CTAGAAGTTCCTGCATGTCTGGG - Intergenic
995032515 5:107495762-107495784 CTAGAAGATCCTGACTTCCGGGG - Intronic
1000150791 5:158498628-158498650 AGAGAAGTTCATGAGTTTGTTGG - Intergenic
1001563921 5:172687394-172687416 CTAGAAGTTGTTCACTTTCTGGG + Exonic
1003099098 6:3163305-3163327 CTAGTATTTCATGAATTTGTGGG - Intergenic
1003105154 6:3209797-3209819 ATAGCAGTTCTTGACATTGTTGG - Intergenic
1003330058 6:5122280-5122302 CTAGAAGTTCCTGACTTTGTGGG + Intronic
1003418256 6:5932602-5932624 CCAGCTGTTCCTGACTTTGAAGG - Intergenic
1003796395 6:9610033-9610055 CTGAAAGATCCTGACTTTTTAGG + Intronic
1005515445 6:26550271-26550293 CTAGGAATGCCTGACTTTCTGGG + Intergenic
1005902389 6:30228196-30228218 CTACAAATTCCTGCCTTGGTTGG - Intergenic
1008219517 6:48838456-48838478 CTAGAAATGCCTGACTTTTTGGG + Intergenic
1010546382 6:77162120-77162142 CTAGAACTCTCTGACTTTGCTGG - Intergenic
1010753460 6:79640479-79640501 CTAAAAGTGCCTAAGTTTGTAGG - Intronic
1014292418 6:119574422-119574444 CTAGAAATTATTGACTTTATTGG - Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1015961124 6:138650290-138650312 CTGGAAGTACCTGAGTATGTAGG - Intronic
1017633984 6:156425588-156425610 TTAGAAATTCCAGACTTTCTAGG - Intergenic
1021860372 7:24900152-24900174 CTCTCAGTTCCTGATTTTGTTGG - Intronic
1026123811 7:67561846-67561868 CTAGGAATGCCTGACTTTCTGGG - Intergenic
1026126156 7:67581606-67581628 CTAGGAATGCCTGACTTTCTGGG + Intergenic
1030377471 7:108770320-108770342 CTTCTAGTTCCTGACTTTGATGG - Intergenic
1031517649 7:122721236-122721258 CAAGCAGTTCCTGGATTTGTTGG - Intronic
1033276511 7:139975715-139975737 CTCGAAGGTCCTGGGTTTGTTGG + Intronic
1034929076 7:155146221-155146243 CTAGAAATTCCTGAATTGGAGGG + Intergenic
1036132017 8:6124349-6124371 AAAGAAGTTCCTGTCTTTGTGGG - Intergenic
1051409619 9:16776022-16776044 GTAGAAGTGCCTGACCTGGTCGG - Intronic
1051809156 9:21031021-21031043 TTAGCAGTTCCTGCCTTTATAGG - Intronic
1057300539 9:93878311-93878333 CTAGAAGTTCATGAATTTGTAGG - Intergenic
1058633599 9:107014936-107014958 CTACCAGTTCCTGACTATGGTGG - Intergenic
1060492897 9:124097998-124098020 CCTGAATTTCCTGACTCTGTGGG - Intergenic
1062620722 9:137420685-137420707 CTTGAAGTTCCTGGATCTGTCGG - Intronic
1185922414 X:4108189-4108211 CCAGACATTCCTGACTTTGAAGG + Intergenic
1186411701 X:9349698-9349720 CTACACGTTCCTGTCTTTGGGGG + Intergenic
1187132937 X:16519415-16519437 CTAGAAGTTCCTGATGTTTTTGG - Intergenic
1187776707 X:22768242-22768264 ATAAAAGTATCTGACTTTGTTGG + Intergenic
1188107471 X:26161521-26161543 CTGGAAGTTCCTGGGTCTGTTGG + Intergenic
1188997414 X:36903184-36903206 ATTGAAGTGCCTGATTTTGTGGG + Intergenic
1193764400 X:85508601-85508623 CTAGAAACGCCTGATTTTGTAGG + Intergenic
1194759392 X:97776476-97776498 CTAGGAGTTCCTCACTTTGATGG + Intergenic
1196635398 X:117996017-117996039 CTAGGAGTTTCTGAATTTCTGGG + Intronic
1196711595 X:118769257-118769279 CTAGATGTTCATGACCTAGTGGG + Intronic
1196975711 X:121155528-121155550 CTAGGAATGCCTGACTTTCTGGG - Intergenic
1197724971 X:129770117-129770139 TTAGTAGTACCTGTCTTTGTGGG - Intergenic