ID: 1003331235

View in Genome Browser
Species Human (GRCh38)
Location 6:5130290-5130312
Sequence ACGTGTGAGCCCTGGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003331227_1003331235 15 Left 1003331227 6:5130252-5130274 CCAACGCTGGGATTCTGGGATTA 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1003331235 6:5130290-5130312 ACGTGTGAGCCCTGGGAATCTGG 0: 1
1: 0
2: 0
3: 18
4: 131
1003331224_1003331235 23 Left 1003331224 6:5130244-5130266 CCTGGAGGCCAACGCTGGGATTC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1003331235 6:5130290-5130312 ACGTGTGAGCCCTGGGAATCTGG 0: 1
1: 0
2: 0
3: 18
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003331235 Original CRISPR ACGTGTGAGCCCTGGGAATC TGG Intronic
900531652 1:3156772-3156794 CCATGTGGGCCCTGGGACTCTGG - Intronic
901850842 1:12014253-12014275 AAGTGTGTAGCCTGGGAATCTGG - Intergenic
903145386 1:21368710-21368732 AGGTGGGAGGCCTGGGAATGGGG + Intergenic
903168495 1:21537745-21537767 ACGTGGGAGCGCTGGGATTCAGG - Intronic
903538951 1:24086050-24086072 AGGTGGGAGCCCTGGGAAGCTGG + Intronic
903577317 1:24346862-24346884 ACGTGGGAGTCCTGGGCAGCTGG + Intronic
907310884 1:53538462-53538484 ATGAGTGAGCGCTGGGACTCTGG - Intronic
909896324 1:81074695-81074717 CCAGGTGTGCCCTGGGAATCTGG - Intergenic
915055905 1:153130305-153130327 AGGGGTGAGCCCTGATAATCTGG - Intergenic
916211175 1:162361073-162361095 ACATCTGAGCCCTGGCACTCGGG + Intronic
917911759 1:179655066-179655088 ACGTGGGTGCTCTGGGAAACAGG - Intronic
918325459 1:183405557-183405579 ACATGGGAGCCCTGGGAATAGGG + Intronic
918627747 1:186677743-186677765 ATGTTTGAGCCCTGGGGATCAGG + Exonic
920875711 1:209833581-209833603 AAATGTGAGGCCTGGGAAGCTGG - Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
1063044489 10:2377683-2377705 AGGTGTGAGCCCTTGGAATGTGG + Intergenic
1063569554 10:7202253-7202275 AAAAGTGAGCCATGGGAATCTGG + Intronic
1065490146 10:26274659-26274681 ACTTGTGAGCCCTGGGCATGTGG + Intronic
1067278895 10:44856674-44856696 ACCTGTGTCCCCTTGGAATCTGG - Intergenic
1070760633 10:79022107-79022129 ACGGCTGAGCTCTGGGAACCCGG + Intergenic
1075564741 10:123495068-123495090 ATGTGTGAGCCCAGAGATTCTGG - Intergenic
1075833444 10:125430994-125431016 ACATGTATGCCCTTGGAATCAGG - Intergenic
1076165423 10:128278593-128278615 ACGTGTCAGCGCTGGTCATCTGG + Intergenic
1079469056 11:20760861-20760883 CCAAGTGAGACCTGGGAATCTGG - Intronic
1081862624 11:46342180-46342202 ATGTGCCAGCCCTGGGAAGCTGG - Intronic
1083714968 11:64569866-64569888 ACCTGTGATCCCTGGGCATCGGG + Intronic
1088581590 11:111321558-111321580 AGGTGTCATCCCGGGGAATCAGG + Intergenic
1090423872 11:126593776-126593798 ATTTGTGAGCCCTAGGAAGCTGG + Intronic
1090751604 11:129750822-129750844 ACGTGAGAGCCCTGGCTGTCTGG + Intergenic
1092247501 12:6871830-6871852 AGGTTAGAGCCCAGGGAATCCGG + Intronic
1093590696 12:20898886-20898908 GCTTGGGAACCCTGGGAATCTGG + Intronic
1093618054 12:21252225-21252247 GCTTGGGAGGCCTGGGAATCTGG + Intergenic
1097188350 12:57207865-57207887 ACGTGTGAGAGCTGCGAGTCTGG + Intronic
1101325718 12:103713835-103713857 ACGTGTGTGCCCTGATTATCAGG + Intronic
1102490296 12:113286475-113286497 ACGTGTGTGCCCTGCGTGTCTGG + Intronic
1110392581 13:74992673-74992695 ATGTGAGAGCCTTGGGAAGCAGG - Intergenic
1112917885 13:104573426-104573448 AGGTGAGAGCTCTGGGAATTTGG + Intergenic
1116596370 14:46852305-46852327 AAGTGTGATCCCTGGGAAATGGG + Intronic
1118849573 14:69573516-69573538 TCCTGTGCGCCCTGGGAATCAGG + Exonic
1121113556 14:91328650-91328672 ATGTAGCAGCCCTGGGAATCGGG - Intronic
1122425050 14:101601015-101601037 ATGTGAGAGGCCTGGGAACCAGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123040602 14:105488728-105488750 ACAAGGGAGCCCTGGGCATCTGG - Intronic
1123694564 15:22869074-22869096 CCATGTGAGCCCTGTGGATCGGG + Exonic
1128519466 15:68365924-68365946 ACCTGTGTGCCCTGGGAGCCAGG - Intronic
1129978560 15:79845680-79845702 ATGAATGAGGCCTGGGAATCTGG - Intronic
1130243195 15:82217703-82217725 AGGTGTGAACACTGGGAAGCAGG - Intronic
1132519223 16:379754-379776 GGCTGTGAGCCCTGGGAGTCGGG - Intronic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1138047348 16:53739103-53739125 AAGTGTGAGCCATCGCAATCTGG + Intronic
1143455375 17:7064368-7064390 CCGTGTGAGCCCTGGGGTTGTGG + Intergenic
1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG + Intronic
1147186063 17:38713619-38713641 CCAGGTGAGCCCTGGGAAGCAGG - Intronic
1148070484 17:44905898-44905920 ACGTGTCAGCCCTGAGCACCCGG + Intronic
1148075235 17:44932022-44932044 GGGTGTGAGGCCTGGGTATCGGG - Intronic
1152088520 17:78234357-78234379 ACATGTGAGGCCTGGGGATGGGG + Intronic
1155170309 18:23262353-23262375 ATCTGTGAGCCCTGGGAACCTGG - Intronic
1156803327 18:41145422-41145444 ACCTGTTAGCCATGGGAAACTGG - Intergenic
1157966800 18:52217645-52217667 ATGTCTGAGCCCTGGGACACTGG - Intergenic
1160869103 19:1269005-1269027 AGGCCTGAGGCCTGGGAATCGGG + Intronic
1161504850 19:4638531-4638553 AGCTGTGAGTCCTGGGAACCAGG - Intergenic
1161684857 19:5697667-5697689 ACGTGGGAGCCCTGGAGAGCTGG + Intronic
1161848365 19:6725396-6725418 AGGTGTGAGCCGGGGGCATCTGG - Intronic
1162357246 19:10194079-10194101 GCCTGTGAGCCGTGGGCATCAGG - Intronic
1164272137 19:23682537-23682559 GCTTGAGAGCCCTGGGAAGCTGG - Intronic
1167490833 19:49792088-49792110 AGGTGGGAGCCCTGGGTATCCGG - Intronic
1167490863 19:49792162-49792184 AGGTGGGAGCCCTGGGTATCCGG - Intronic
1167490892 19:49792237-49792259 AGGTGGGAGCCCTGGGTATCCGG - Intronic
1167490920 19:49792312-49792334 AGGTGGGAGCCCTGGGTATCCGG - Intronic
1167490934 19:49792349-49792371 AGGTGGGAGCCCTGGGTATCCGG - Intronic
1168275640 19:55276848-55276870 ACGTGTCAGGCCTGGGAGTCAGG - Intronic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
926696664 2:15774380-15774402 ACATGGGAGCTCTGGGACTCTGG - Intergenic
928755938 2:34525823-34525845 AGTTGTGAGCCCTGGAAAGCAGG - Intergenic
928926665 2:36586660-36586682 AGGTGTGAGCCATGGCAACCTGG - Intronic
931476210 2:62590272-62590294 ACTTGTGAGCTATGGGATTCTGG + Intergenic
931534519 2:63258339-63258361 ACCTGTCAGCCCTGGTATTCAGG + Intronic
936017371 2:108970020-108970042 ACGTCTGAGCCTTGGCTATCTGG + Intronic
936724215 2:115292996-115293018 AGGTATGAGCCCTGGCACTCAGG + Intronic
937239214 2:120449578-120449600 ACTTGTGATCCCTGGGATGCAGG + Intergenic
937346886 2:121131751-121131773 ACGGATGTTCCCTGGGAATCCGG - Intergenic
942343349 2:174973714-174973736 AAGTGTGGGCCCTGGAAGTCTGG + Intronic
947676648 2:231987615-231987637 ATGCGTAAGCACTGGGAATCTGG + Intronic
948599500 2:239100292-239100314 ACGTGACAGCTCTGGGAAACTGG - Intronic
1169142385 20:3233813-3233835 ACCTGTGAGTCCTGGGGCTCTGG - Intronic
1172217052 20:33243158-33243180 ATCTGTGAGCACTGGGAAGCTGG - Exonic
1174498977 20:50970165-50970187 ACGTTTGACCCCTGAGATTCTGG - Intergenic
1176076154 20:63249093-63249115 ACGTGGGTGCCCCGGGAATGAGG + Intronic
1180025451 21:45158605-45158627 ACCTGTGAGCCCTGGGCATGAGG - Intronic
1180070825 21:45435179-45435201 AGGTGTGAGTCCTGGGAAGTGGG + Intronic
1180079872 21:45481811-45481833 TCCCGTGAGCCCTGGGACTCTGG + Intronic
1181714236 22:24712594-24712616 ACAAGGGAGCCCTGGGCATCTGG - Intergenic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1185142105 22:49108287-49108309 TCGTGTGAGCTCCAGGAATCAGG - Intergenic
950133422 3:10563509-10563531 ACGTGTAAGGTCTGAGAATCAGG + Intronic
952259811 3:31729216-31729238 ACGTGTGAGCTCTGTCATTCAGG + Intronic
954715286 3:52523803-52523825 ACCTGTGAGCCCGGGGAAGGTGG + Intronic
954851533 3:53604968-53604990 ACATGTGAGCTCTGGGAAGCAGG - Intronic
960697153 3:120407333-120407355 AAGTGTCAGCCCTGGCCATCAGG + Intronic
966801114 3:183764954-183764976 TCTTGAGATCCCTGGGAATCTGG + Intronic
966930869 3:184674668-184674690 ACCTGTTAGCCTTGGGACTCAGG + Intronic
969312957 4:6364743-6364765 AGGTCTGAGCCCTGGCAGTCTGG + Intronic
972195589 4:36649844-36649866 ACTTGATAGGCCTGGGAATCAGG + Intergenic
978382253 4:108141670-108141692 AGTTGTGCGCCCTGGGAATATGG + Intronic
984755615 4:183323446-183323468 ACGGTGCAGCCCTGGGAATCTGG - Intergenic
984979906 4:185270432-185270454 ACCTGGGTGCCCTGGGAAGCAGG + Intronic
988366405 5:30305905-30305927 AAGTCTGAGCCCTGAGAAGCAGG - Intergenic
998146392 5:139731458-139731480 AAGTGTGAGCCCCGGCAGTCTGG + Intergenic
999060789 5:148632805-148632827 ACGTGTCAGCCGGGAGAATCTGG + Intronic
1000410339 5:160930693-160930715 AGGTGTGAGACCTGGGCCTCAGG - Intergenic
1000980121 5:167807849-167807871 ACGGGTGTGACCTGGGCATCAGG - Intronic
1001761887 5:174214344-174214366 AGGTGTGTGCCCTGGGGAACAGG - Intronic
1003331235 6:5130290-5130312 ACGTGTGAGCCCTGGGAATCTGG + Intronic
1008607349 6:53153012-53153034 ACTTGTCAGCCCTGAGAGTCTGG - Intergenic
1010610562 6:77950041-77950063 ACTTGTGAGCTCTGGAACTCAGG + Intergenic
1011220905 6:85053446-85053468 ACTTCTCAGCCCTGGGAATGGGG + Intergenic
1014477380 6:121890108-121890130 TCTTTTGAGCCCTGGGGATCAGG + Intergenic
1016120894 6:140340066-140340088 AAGTGGGAGTCCTGGGAATTGGG + Intergenic
1018984459 6:168625707-168625729 CCGTGTGAGCCCTGGGCCCCAGG + Intronic
1019127803 6:169852510-169852532 ATGTGTCAGCCTTGGGAATGTGG - Intergenic
1019275067 7:171823-171845 AGGTGTGAGCCGTGGGGCTCTGG - Intergenic
1022379242 7:29844170-29844192 ACGTGTCATCACTGGGTATCTGG + Intronic
1023828458 7:44025229-44025251 ATGTCTGAGCCCTGGGACACTGG + Intergenic
1029100543 7:98126350-98126372 GGGGTTGAGCCCTGGGAATCTGG + Intronic
1029756759 7:102578656-102578678 ATGTCTGAGCCCTGGGACACTGG + Intronic
1031035324 7:116782232-116782254 ATGTGTAAGCCCTGGGGATGTGG + Intronic
1032125329 7:129189026-129189048 ACCTGTGCGCCCAGAGAATCCGG - Exonic
1032496337 7:132365650-132365672 TCTTGTGTGCCCTGGGTATCAGG - Intronic
1034949043 7:155284699-155284721 CCGTGTCATCCCTGGGAACCTGG + Intergenic
1035196794 7:157228635-157228657 CCGTGTCACCCTTGGGAATCAGG - Intronic
1035231173 7:157466906-157466928 TCTTTTGAGCCCTGGGAACCTGG + Intergenic
1042343695 8:67705842-67705864 CCGTGTGAGCCCTGTGAAAGGGG - Intronic
1046783558 8:118241638-118241660 ACGGATGAGCTCTGTGAATCTGG + Intronic
1049286960 8:141781027-141781049 ACGTGGGCGCCCTGGGAAAGGGG - Intergenic
1049367085 8:142245297-142245319 AAGTGTGATCCCTGGGTCTCAGG - Intronic
1051221723 9:14856257-14856279 ACGTTTGAACCCAGGCAATCTGG + Intronic
1052300360 9:26946878-26946900 ACAGGTGAGCGCTGGGAGTCGGG - Exonic
1052893174 9:33722094-33722116 ACGTGAGAGCCCTGGCTATCTGG + Intergenic
1052996134 9:34552454-34552476 ATCTGTGAGCCTTGGGAAACAGG - Intronic
1053098987 9:35353449-35353471 ACTGGAGAGCCCTGGGAGTCAGG + Intronic
1053533188 9:38901576-38901598 TCGTGTGAGCCCCGGGAAGAAGG + Intergenic
1053715675 9:40885079-40885101 ACGTGTGAGGACGGGCAATCGGG + Intergenic
1054205414 9:62126005-62126027 TCGTGTGAGCCCCGGGAAGAAGG + Intergenic
1054632947 9:67462365-67462387 TCGTGTGAGCCCCGGGAAGAAGG - Intergenic
1056063758 9:82911727-82911749 ACTTGTGATGTCTGGGAATCTGG - Intergenic
1057384249 9:94593538-94593560 ACCTGTGAGTCCTGGGGAGCAGG - Exonic
1058422586 9:104846738-104846760 ATGTGGGAGTCCTGGGACTCTGG - Intronic
1191767082 X:64709782-64709804 GCCTGTGAGCCCTGGAACTCCGG + Intergenic
1197157821 X:123289514-123289536 AGAAGTGAGACCTGGGAATCTGG + Intronic
1201068822 Y:10125901-10125923 AAGTCTGATCCATGGGAATCTGG - Intergenic