ID: 1003331253

View in Genome Browser
Species Human (GRCh38)
Location 6:5130390-5130412
Sequence CTGGCATTGCACAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003331248_1003331253 -9 Left 1003331248 6:5130376-5130398 CCCTGTTCGTCAGGCTGGCATTG 0: 1
1: 3
2: 385
3: 14288
4: 77451
Right 1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG 0: 1
1: 0
2: 3
3: 25
4: 210
1003331244_1003331253 23 Left 1003331244 6:5130344-5130366 CCAAGCAGGGGCTAGAGAGCAAG 0: 1
1: 0
2: 2
3: 61
4: 1279
Right 1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG 0: 1
1: 0
2: 3
3: 25
4: 210
1003331249_1003331253 -10 Left 1003331249 6:5130377-5130399 CCTGTTCGTCAGGCTGGCATTGC 0: 1
1: 0
2: 2
3: 7
4: 289
Right 1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG 0: 1
1: 0
2: 3
3: 25
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003331253 Original CRISPR CTGGCATTGCACAGGGGACC TGG Intronic
901092117 1:6648870-6648892 CTGGGTCTGCAAAGGGGACCGGG - Intronic
901640463 1:10690544-10690566 CTGGCAATGCAAGGGGGTCCTGG + Intronic
901668392 1:10839353-10839375 CTGGCAGTGCAGAGAGGACTGGG + Intergenic
902272035 1:15311427-15311449 CTTGCACTACACAGGGCACCTGG + Intronic
902920125 1:19661013-19661035 CCGTCAGTTCACAGGGGACCGGG - Intergenic
903667712 1:25018026-25018048 CTGGCCTTCCACAGGGCTCCTGG + Intergenic
912493426 1:110075833-110075855 CTGGGAGAGCACAGGGGGCCTGG + Intergenic
918231098 1:182532913-182532935 CTGGCTTTGCACACAGGACCTGG - Intronic
918406823 1:184219656-184219678 CCTGCATTGCACAGGGGATAGGG + Intergenic
919896605 1:202013072-202013094 TTAGCAATGCACAGGGGGCCCGG + Intronic
920636633 1:207710719-207710741 CTGGCATTGCACACGGTGCGGGG - Intronic
922345539 1:224693312-224693334 CTGGCTTTTCACTGGGGATCTGG + Intronic
922542874 1:226432613-226432635 CTGGAATTGCACAGGGATCATGG + Intergenic
1064362533 10:14679002-14679024 CTGGCATCCCACAGGGGTGCTGG + Intronic
1065729892 10:28700947-28700969 CTGGCATTGCCAAGGGGACAAGG + Intergenic
1067370536 10:45678270-45678292 CTGGCACTGCACGAGGGGCCAGG + Intergenic
1067416826 10:46109072-46109094 CTGGCACTGCACGAGGGGCCAGG + Intergenic
1067445012 10:46336663-46336685 CTGGCACTGCACGAGGGGCCAGG + Intergenic
1067502225 10:46815955-46815977 CTGGCACTGCACGAGGGGCCAGG + Intergenic
1067567382 10:47348991-47349013 CCGGCACTGCACAGGAGGCCAGG + Exonic
1067639477 10:48032138-48032160 CTGGCACTGCACGAGGGGCCAGG - Intergenic
1067817542 10:49493747-49493769 CTGGCATGGCCCAGGTGACATGG + Intronic
1069381276 10:67845147-67845169 CTGGGATTGAACAGAAGACCTGG + Intergenic
1069634922 10:69919186-69919208 CTGGCCTGGGACTGGGGACCTGG + Intronic
1069773435 10:70913551-70913573 CAGGCAGCGCACAGGGGACCTGG - Intergenic
1070014743 10:72515162-72515184 CTGCCATTGCACTGGGGACTTGG + Intronic
1070136464 10:73698288-73698310 CTGGCACTGCACGAGGGGCCAGG - Intergenic
1072303625 10:94086005-94086027 CTGGCATTGTACTGGGCACAGGG - Intronic
1076104858 10:127813569-127813591 CTGGCATTTCACAGAGGAGAGGG - Intergenic
1076520112 10:131076126-131076148 CAGGCATTGCACAGAGGCCCAGG - Intergenic
1081253770 11:40867891-40867913 CTGGCAATGCACAAGGGAAACGG + Intronic
1081524771 11:43919716-43919738 CTGGCATAGCACAGTGGGGCTGG + Intronic
1082080804 11:48011086-48011108 CTGCCTTTGCCCAGGGGCCCTGG - Intronic
1082806860 11:57457358-57457380 CTGGCTTTGGAAAGGAGACCAGG - Intergenic
1083310765 11:61782516-61782538 CTGGCTCTGTACAGGGGACTGGG + Intronic
1084024135 11:66437357-66437379 CTGGGATTGAAAAGGGGGCCCGG - Exonic
1087479484 11:98681017-98681039 CTGGGATTACAGAGGGGCCCCGG + Intergenic
1089555376 11:119313050-119313072 CTGGCCTTCTACAGGGGACAGGG - Intronic
1089651854 11:119919807-119919829 ATGGCATTTCAAAGGGAACCTGG - Intergenic
1089874739 11:121709185-121709207 CTGGGACAGCACAGGGGACACGG + Intergenic
1091218910 11:133919364-133919386 CTGGCATCGGGCAGGGGTCCTGG - Intronic
1092731420 12:11538596-11538618 CAGGCACTGCAGAGGGGAGCCGG - Intergenic
1095096060 12:38149948-38149970 CCTGCATTGCACAGGTGGCCAGG + Intergenic
1096783680 12:54005159-54005181 CTGGGATTGAACAGTGGGCCGGG - Intronic
1096956264 12:55529448-55529470 CTGGGCTTGAACTGGGGACCAGG - Intergenic
1102694373 12:114786724-114786746 CTGGCATTCCACAGGGAACAAGG + Intergenic
1103904984 12:124322540-124322562 CTGACACTGCACACGGGACCGGG + Intergenic
1103937137 12:124482724-124482746 CTGGCATTGCAGGTGGGCCCAGG - Intronic
1105701258 13:22937320-22937342 CTGGCCTGGCAGTGGGGACCAGG + Intergenic
1105854093 13:24360375-24360397 CTGGCCTGGCAGTGGGGACCAGG + Intergenic
1108302876 13:49097544-49097566 CTGGCACTTCCCAGGGGAACTGG - Intronic
1111829692 13:93311710-93311732 CTGGCACTGCATAGGGGTCAAGG - Intronic
1113203116 13:107888362-107888384 CTGAGATTGCACAGGGCAGCGGG + Intergenic
1114485082 14:23057403-23057425 CTGGCACTGCCGAGGGGCCCAGG + Exonic
1114547626 14:23514064-23514086 CTGGCACTGCCCATGGCACCTGG + Intergenic
1118459602 14:65976241-65976263 CTGTCTATGCACAGGGGACAAGG + Intronic
1118600863 14:67470713-67470735 CTGGCATTGAAGAGGGGACAGGG + Exonic
1120206977 14:81597558-81597580 CTGGTTTTGGACAGGTGACCAGG - Intergenic
1121235642 14:92389698-92389720 CTGGCTTAGCACAGGGGATGTGG - Intronic
1122319688 14:100846318-100846340 CTTGCCTTGCCCAGGGGGCCTGG + Intergenic
1124507673 15:30292305-30292327 GTGGCACCGCACAGGGCACCTGG - Intergenic
1124735883 15:32246353-32246375 GTGGCACCGCACAGGGCACCTGG + Intergenic
1126098925 15:45108113-45108135 ATGGCACTGAACAGGGGTCCAGG + Exonic
1126483045 15:49148560-49148582 CTGGTATTGAACAGAGGAACAGG + Intronic
1127901675 15:63345651-63345673 CTGGCAGTGCACAGCTGGCCGGG - Intronic
1128525797 15:68411437-68411459 CAGGCAGAGCACAGGAGACCAGG + Intronic
1132647689 16:1006711-1006733 CTGGAGCTGCGCAGGGGACCTGG + Intergenic
1133303516 16:4796833-4796855 CTGGCATGGCACAGGGAACGCGG + Intergenic
1133380072 16:5322429-5322451 CTGGCCATGCCCAGGGCACCCGG - Intergenic
1134223510 16:12374087-12374109 GTGGTATTCCAGAGGGGACCTGG - Intronic
1137558421 16:49488041-49488063 CAGGCACTGCACAGGGCACTGGG - Exonic
1138189559 16:55003410-55003432 CTGGCAATGCTCAGTGGACCTGG + Intergenic
1138418843 16:56886487-56886509 CTGGAGGGGCACAGGGGACCAGG + Intronic
1138427609 16:56946640-56946662 CTGGGATTCTCCAGGGGACCTGG - Intergenic
1141148999 16:81551433-81551455 CAGACATGGCACATGGGACCTGG + Intronic
1141432666 16:83978796-83978818 CTGGTTTTGCACAGTGGACATGG + Intronic
1142002217 16:87670442-87670464 ATGGCACTGCACTGGGCACCAGG + Intronic
1147251860 17:39157461-39157483 CTGGCACCGCACAGGGAACATGG + Intronic
1147563245 17:41521627-41521649 CTGGCATTTCCCTGGGGAACAGG - Exonic
1148141670 17:45333489-45333511 CTGGCAGTGCCCAGGAGAGCTGG - Intergenic
1152867622 17:82733881-82733903 CTGGGATTACACATGGCACCCGG - Intergenic
1153097779 18:1427798-1427820 CTGGCCCTGCACAGGGCCCCTGG - Intergenic
1153749409 18:8213273-8213295 TTGGCATTGCAGAGGAGAACAGG + Intronic
1154046048 18:10905862-10905884 CAGGCATTGCCCACGGCACCAGG + Intronic
1156825307 18:41424076-41424098 CTGGCATGGCTCAGGGGATGGGG - Intergenic
1157294119 18:46430007-46430029 CAGCCATTCCACAGGGGAGCAGG - Intronic
1157562523 18:48658952-48658974 CAGGCAGTGCCCAGGGGGCCAGG - Intronic
1158281394 18:55832195-55832217 GTGGCCTTGCACAAGGGACAGGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158894091 18:61897122-61897144 CTGGCATTGCCCTGGAGACTGGG + Intergenic
1159076654 18:63688389-63688411 CTGACATTGCTAAGGGGACTGGG + Intronic
1160511383 18:79455450-79455472 CTGGCATCTCACAGGCGGCCGGG + Intronic
1160951830 19:1671494-1671516 CTGGCATTGGCCAGGGGAACTGG + Intergenic
1161377433 19:3947214-3947236 CAGGCATGGGACAGTGGACCTGG - Intergenic
1161729114 19:5948111-5948133 CTGGCCTTTCCTAGGGGACCAGG - Intronic
1163649402 19:18508552-18508574 CTGGCACTGCACAGGGGCCTGGG + Intronic
1164589169 19:29496661-29496683 CTGGCAGTGGCCAGGGGACTGGG - Intergenic
1165314795 19:35048239-35048261 GTGGCTGTACACAGGGGACCTGG + Intronic
1166746554 19:45144631-45144653 CTGGGAGTGGACGGGGGACCTGG + Intronic
1167063383 19:47165840-47165862 CTGGGATTGCCCAGTGGCCCTGG - Intronic
1167175137 19:47860029-47860051 CTGGCCTGGCGCAGGGGACGGGG + Intergenic
925038259 2:708888-708910 CAGGCTTTGCTCAGGGGACATGG - Intergenic
925764299 2:7215767-7215789 CTGTCATTGCAGAGAGGGCCTGG + Intergenic
925826808 2:7857490-7857512 CAGGCTGTGCACAGGGGTCCAGG + Intergenic
926937975 2:18105041-18105063 CAGGCTATGCACAGGGGCCCAGG - Intronic
927010312 2:18897252-18897274 CTGTCATTGCAGATGGGACTTGG + Intergenic
927173920 2:20392218-20392240 GAGGCATTGCTCAGGTGACCAGG - Intergenic
929589034 2:43133396-43133418 CTTGCAAGGCACAGGGGATCTGG + Intergenic
929822641 2:45285722-45285744 ATGGCATGTCATAGGGGACCAGG - Intergenic
935649445 2:105369868-105369890 CAGGGAATGCACAGGGCACCTGG + Intronic
936066898 2:109339448-109339470 GGGGCCTTGCACTGGGGACCTGG - Intronic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
937314832 2:120925109-120925131 CTGGCCCTGCACAGGTGAGCCGG - Intronic
940006653 2:149014516-149014538 CTGGCATTGGACAAGGGACCTGG + Intronic
941756426 2:169191438-169191460 CTGGCCTTGCACAGAGGGCCAGG - Intronic
941897458 2:170643783-170643805 CAGGCAACGCACAGGGGTCCTGG - Intronic
944601638 2:201309342-201309364 TTGGCATTGCACAGTGGCCAGGG + Intronic
946430647 2:219625535-219625557 TCGGCATTGCACAGGGGCTCTGG - Intergenic
948460627 2:238128420-238128442 CTGGGCTTGCACAGGGGACGGGG + Intronic
949026329 2:241768055-241768077 CCGGCAGTGGGCAGGGGACCAGG + Exonic
949072078 2:242031426-242031448 CTGGCATTGCACACGGGACGGGG + Intergenic
1170016894 20:11791601-11791623 CTGGCCCGGCAAAGGGGACCTGG + Intergenic
1170969659 20:21105149-21105171 ATGGCATTCGAAAGGGGACCCGG - Intergenic
1172707547 20:36893426-36893448 CTTTTATTGCAGAGGGGACCAGG - Exonic
1173409831 20:42800337-42800359 CTGGCCTTGCGCTGGGGAGCTGG + Intronic
1175318825 20:58071241-58071263 CAGGAAATGCACAGGGCACCAGG - Intergenic
1175333861 20:58182352-58182374 CTGGCATGTCACAGGGCCCCTGG - Intergenic
1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG + Intergenic
1176151024 20:63590746-63590768 ATGGCATCACACAGGGGACGGGG + Intronic
1176672847 21:9750847-9750869 CTGGCATTGCAGAGGAGACGGGG + Intergenic
1177398010 21:20562680-20562702 ATTGTATTGCACAGGGAACCAGG - Intergenic
1178445369 21:32636081-32636103 CTGGCAGTGGACAGGAGATCAGG + Intronic
1178578196 21:33814050-33814072 CTGGCCTAGCACAGGAGACGGGG - Exonic
1180006848 21:45026726-45026748 CAGACATTGCGCAGGGGACATGG + Intergenic
1181327465 22:22060922-22060944 CTGGGACTGCACACGGGCCCAGG + Intergenic
1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG + Intergenic
1182258252 22:29053520-29053542 CTGGCACCACACATGGGACCAGG - Intronic
1182691632 22:32168093-32168115 CAGGCCTTGCACAGGGCACTGGG + Intergenic
1184252964 22:43271322-43271344 TAGGCATTGTACAGGGGACGAGG - Intronic
1185043128 22:48515817-48515839 CTGGCATTGGCCAGGGGATGGGG + Intronic
949283869 3:2378430-2378452 TTGGCCATGCACAGGGGACTGGG + Intronic
950460350 3:13117970-13117992 CCAGCAGTGCACAGGGGGCCCGG - Intergenic
951716094 3:25648148-25648170 CTGACATTGAACAGGGTGCCAGG + Intronic
951946938 3:28148832-28148854 CTCCCATTGCACAGGGGCCCAGG - Intergenic
952786421 3:37160056-37160078 CTAGCAATGGAAAGGGGACCTGG - Intronic
953768483 3:45761559-45761581 CTGGCATTTCCTAGGTGACCAGG + Intronic
953827506 3:46266837-46266859 CTGACATTGCAGAGGAGGCCAGG + Intergenic
953980135 3:47409491-47409513 CTGTCAGTGCACAGAGGACACGG - Exonic
954368253 3:50157215-50157237 CTGGGATGGGACAGGGGGCCAGG - Intronic
960049778 3:113228563-113228585 CTGGAATGGCACATGGGGCCTGG - Intronic
960120997 3:113948311-113948333 CTGGCAGTGCTCAGGGGTCGCGG - Intronic
964695632 3:159504831-159504853 CTGACAGTCCACAGGGGACATGG + Intronic
968588695 4:1446880-1446902 CTGGCCTGGCACAGGGGACCCGG - Intergenic
968750650 4:2387202-2387224 CTGGCAGTCCACTGGGAACCCGG + Intronic
969505625 4:7585438-7585460 CTTGCCTGACACAGGGGACCAGG - Intronic
972365798 4:38373216-38373238 CTGGCAGTGCAGAGTGGACCTGG - Intergenic
974664151 4:64936331-64936353 CTACCATTTCACTGGGGACCAGG + Intergenic
976310065 4:83602572-83602594 CTGCCATTGCAAAGGGGAATTGG + Intronic
977405316 4:96590332-96590354 CTGGCATTGAACATGTGAGCTGG - Intergenic
979596928 4:122544470-122544492 CTGGCCTTGAGAAGGGGACCAGG - Intergenic
985401843 4:189600779-189600801 CTGGCATTGCAGAGGAGACGGGG - Intergenic
985401856 4:189600874-189600896 CTGGCGTTGCAGAGGAGACGTGG - Intergenic
985401867 4:189600969-189600991 CTGGCATTGCAGAGGAGACGTGG - Intergenic
985508184 5:296758-296780 CTGGCATTGCACATGGGTGGGGG + Intronic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985739854 5:1608913-1608935 CTGGCATTGCACATGGGTGGGGG - Intergenic
988537756 5:32084164-32084186 CTGGCCTTCCACAGTGGGCCTGG + Intronic
990346867 5:54880215-54880237 ATGGCCTTGCACAGTGGACATGG - Intergenic
990502214 5:56407902-56407924 CTGGCAGTGGCCAGGGGACCAGG + Intergenic
992124169 5:73624930-73624952 CTGGCATTGCACTCCTGACCTGG - Intergenic
992430733 5:76709030-76709052 CTAGCATTGGAAAGGGGAACAGG + Intergenic
993204480 5:84862486-84862508 CTTGCATTCCACAGTGGAACTGG + Intergenic
994124875 5:96157543-96157565 GTGGCATTCCACAGTGCACCTGG - Intergenic
996833613 5:127767206-127767228 CTGACATTTCACAGGGGCCTGGG - Intergenic
998426936 5:142036820-142036842 CTGGGATTGAAAAGGGGGCCCGG - Intergenic
998729799 5:145061889-145061911 CTGGCATGGCAGAGGTGATCAGG + Intergenic
1001641101 5:173244666-173244688 GGGGCATGGCACGGGGGACCCGG + Intergenic
1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG + Intronic
1004706163 6:18125662-18125684 ATGGCATTGCTCAGGGAAACAGG - Intergenic
1006444152 6:34069505-34069527 CTGGGACTGCACAGAGGGCCAGG + Intronic
1007356506 6:41321673-41321695 CTGACATTTCACTGGGGCCCTGG + Intergenic
1008434957 6:51465213-51465235 CTGGCATTTCCAAGGGTACCTGG + Intergenic
1010765644 6:79775306-79775328 CTGGCATTGTACAAGTGGCCAGG - Intergenic
1011795486 6:90947683-90947705 CTGAGATTGGACAGGGCACCAGG - Intergenic
1013010609 6:106116619-106116641 CTGGCACTTCACAGGGGAACTGG - Intergenic
1015096962 6:129427469-129427491 CTGGCATTCCACAGAGGAAAAGG - Intronic
1017790148 6:157790650-157790672 CTGGGATAACACAGGAGACCTGG + Intronic
1018349680 6:162943554-162943576 CAGGCATTTCACTGGGGGCCTGG + Intronic
1019821528 7:3246905-3246927 CTGGCATTGCTCCGGGGACAGGG + Intergenic
1019959605 7:4448223-4448245 GTTGCTTTGCACAGGGGGCCTGG + Intergenic
1019995411 7:4721257-4721279 GTGGCAGTGCACAGGGGCCTTGG + Intronic
1020059965 7:5144444-5144466 CCGGCACTGCACTGGGGTCCTGG - Intergenic
1021961022 7:25873094-25873116 ATGGCATTGGACAGGGTCCCTGG - Intergenic
1022500709 7:30880887-30880909 CAGGAATTTCACTGGGGACCTGG + Intronic
1022574335 7:31482934-31482956 CTGAGAATGCCCAGGGGACCTGG + Intergenic
1023594615 7:41815701-41815723 CTGGTCATGCACAGGGGAGCTGG - Intergenic
1025607387 7:63049026-63049048 CTCGCACAGGACAGGGGACCAGG - Intergenic
1026477528 7:70749681-70749703 CTGCTATGGCCCAGGGGACCTGG - Intronic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1029597728 7:101546602-101546624 ATGGCATTGCCCTGGGGCCCTGG + Intronic
1029622078 7:101696552-101696574 CTGGCTCTGCACTGGGCACCAGG - Intergenic
1032574849 7:133042526-133042548 CTGCGATGACACAGGGGACCAGG + Intronic
1032628259 7:133617567-133617589 CTAGCATGGCACAGGAGAACAGG + Intronic
1034311846 7:150095331-150095353 CTGGCTTTGCTCAGGGGCCGGGG - Intergenic
1034511453 7:151538434-151538456 CTGGCTCTGCACAGTGCACCAGG - Intergenic
1034795008 7:154005323-154005345 CTGGCTTTGCTCAGGGGCCGGGG + Intronic
1034973946 7:155437096-155437118 CTGGGATTGCACCAGGGAGCTGG - Intergenic
1035090216 7:156304235-156304257 CTGGCTTTGCTAAGAGGACCTGG - Intergenic
1035447548 7:158952997-158953019 CTGGCATTGCACAGGTGGGAAGG - Intronic
1036590901 8:10167129-10167151 CTGGCATGGGAGAGGGGACCTGG - Intronic
1036825708 8:11974340-11974362 CTGCCAGTGCACCGGGGACGGGG - Intronic
1038544075 8:28412161-28412183 CCGGCCGTGCGCAGGGGACCAGG + Intronic
1038753192 8:30315985-30316007 CTGCCATGGCACAGAGGCCCTGG - Intergenic
1040414323 8:47183147-47183169 CTGGCATTGAAAAGGAGACAGGG - Intergenic
1040559188 8:48508826-48508848 CTGTCATTTCACAGGAGCCCAGG - Intergenic
1042483979 8:69331720-69331742 CTGGCATTGCACATGGGTGGGGG + Intergenic
1042542185 8:69918600-69918622 TTGGCATTTCAGAGGGGAGCAGG - Intergenic
1044311498 8:90698252-90698274 CTGGAAGTGCACAGGGGGTCTGG + Intronic
1044915889 8:97112445-97112467 GTGGCATGGCACAGAGGACATGG + Intronic
1045456824 8:102388358-102388380 CAGGCATTGTACTGGGGACTGGG - Intronic
1047223363 8:122936990-122937012 CTGGCACTGCACATGTGACTTGG - Intronic
1047262821 8:123276942-123276964 CTGGCATTGGGCAGTGAACCAGG - Intergenic
1048865303 8:138756378-138756400 CCGTCATAGCCCAGGGGACCTGG - Intronic
1049210490 8:141384316-141384338 CTGTCATTGCAGAGGGGGACTGG + Intergenic
1049295346 8:141830618-141830640 CTGGCCTTGCACTGGGCACGAGG - Intergenic
1049666436 8:143845619-143845641 AAGGCATCGCACAGGGGGCCAGG - Intergenic
1057043455 9:91864689-91864711 CTGGCATGTCAGAAGGGACCAGG + Intronic
1057668081 9:97062227-97062249 CTGGGATTCCCAAGGGGACCTGG + Intergenic
1059525331 9:114986087-114986109 CTGGCATGGCACCAGAGACCTGG + Intergenic
1060963333 9:127697059-127697081 CAGGTAATGCACAGGGGACCAGG - Intronic
1061626583 9:131844092-131844114 CTGGCACAGCACTGGGCACCTGG - Intergenic
1062030692 9:134360645-134360667 CTGGCGTTGCATGGGGGACATGG + Intronic
1062048461 9:134435241-134435263 CAGGCCGTGCACAGGGGCCCTGG + Intronic
1062183253 9:135202480-135202502 CTGGCATGGCTCAGAGGGCCTGG + Intergenic
1185518127 X:715904-715926 CGGGCATTGCACAGGGTCCAGGG - Intergenic
1188663573 X:32790872-32790894 TGAGCATTGCACAAGGGACCTGG + Intronic
1189262669 X:39689277-39689299 CTGGCATTTCTCCGGGGACGCGG - Intergenic
1190279932 X:48922902-48922924 CCTGCATTCCACAGGGGACTCGG - Exonic
1195094855 X:101493083-101493105 CTGGGCTGGCACTGGGGACCAGG + Exonic