ID: 1003336145

View in Genome Browser
Species Human (GRCh38)
Location 6:5174697-5174719
Sequence ACTTATAATTGGTAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003336145 Original CRISPR ACTTATAATTGGTAACTGGA AGG Intronic
903235238 1:21946166-21946188 ACTTATAAGTGGGAGCTGGCCGG + Intergenic
904192545 1:28758107-28758129 ATTTAAAATTGCTAACTGGCCGG + Intronic
906130316 1:43451786-43451808 AATTACAAATGGTAAGTGGAAGG - Exonic
907356786 1:53882137-53882159 ACTTATAAGTGGGAGCTGAATGG + Intronic
907771075 1:57464368-57464390 ATTTTTAAATGGAAACTGGATGG - Intronic
908077500 1:60536492-60536514 ACATGTTATTGGAAACTGGAAGG - Intergenic
911066975 1:93798442-93798464 AATTTTTTTTGGTAACTGGATGG + Intronic
911312431 1:96310203-96310225 ATTTATAATTGGGAAGTGGCTGG + Intergenic
919576710 1:199319108-199319130 ACTTATAAGTGGGAACTAAATGG - Intergenic
921899753 1:220437428-220437450 CCTCATAATGGGTAACTGGGAGG + Intergenic
921974588 1:221188237-221188259 ACTGATAATTGGTCAGTTGATGG + Intergenic
923159682 1:231305437-231305459 AATTATGAATGGCAACTGGAAGG - Intergenic
923413704 1:233734290-233734312 ACTTAGAATTGGTAGTTGGTAGG - Intergenic
923946749 1:238896380-238896402 CCTTATAAGGGATAACTGGAAGG - Intergenic
1063502393 10:6566942-6566964 CCTTCATATTGGTAACTGGAGGG + Intronic
1063766717 10:9150000-9150022 AATGATAATTTGTAACAGGAAGG + Intergenic
1064514924 10:16136681-16136703 ACTTATAAGTGGGAACTGAATGG - Intergenic
1064915389 10:20450888-20450910 GCCAATAGTTGGTAACTGGATGG + Intergenic
1066802351 10:39206033-39206055 ACTTCTGACTTGTAACTGGAAGG - Intergenic
1069758124 10:70786299-70786321 CATTATTATTGGTAACTTGATGG + Intergenic
1072131452 10:92498296-92498318 ACACAAAATTAGTAACTGGAAGG + Intronic
1075895783 10:125993458-125993480 ACTGATATTTGGGGACTGGATGG + Intronic
1078285623 11:9951758-9951780 AATTATAAGTGCTGACTGGATGG + Intronic
1079620301 11:22546080-22546102 ATTTTTAATTGGTAAATTGATGG + Intergenic
1081141981 11:39512805-39512827 ACATATTATTGGAAACTGGAAGG - Intergenic
1081281378 11:41212626-41212648 ACTTATAAGTGGGAGCTGAATGG - Intronic
1081344170 11:41961825-41961847 AATTATAATTGGGAACTGCACGG + Intergenic
1084614227 11:70225108-70225130 CCTTATAATTGTGAACAGGAAGG + Intergenic
1086550924 11:88050824-88050846 AAATATAATTAGTAACAGGAAGG + Intergenic
1087085159 11:94210822-94210844 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1087097861 11:94337268-94337290 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1087223730 11:95574744-95574766 GTTTATCATTGGTAAGTGGAGGG - Intergenic
1087870031 11:103281799-103281821 ACTTAAAAATGGTATCTGGTAGG - Intronic
1089054463 11:115574335-115574357 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1093973314 12:25394355-25394377 TCTAATTATTGGTAACAGGAAGG - Intergenic
1095926030 12:47580064-47580086 ACTTAATATTGGTAACTCTATGG - Intergenic
1096087809 12:48877862-48877884 ACATATAAGTAGTAACTGGCAGG - Intergenic
1096395608 12:51263916-51263938 ATTTATAATTAGTAATTGAATGG - Intronic
1100644319 12:96512978-96513000 AAATATAAATGGTACCTGGATGG - Exonic
1104067630 12:125318581-125318603 ACTTATAAGTGGGAGCTGAATGG - Intronic
1106587943 13:31073318-31073340 ACCCCTAATTGGTTACTGGAGGG + Intergenic
1109925713 13:69135890-69135912 AATTATCATTTGTTACTGGATGG + Intergenic
1110396111 13:75030887-75030909 CCATATTATTGATAACTGGAAGG + Intergenic
1114448119 14:22805540-22805562 ACTTATAAGTGGGAGCTGAACGG + Intronic
1114885993 14:26851928-26851950 ACTTATAAGTGAGAACTTGAGGG + Intergenic
1115008807 14:28519572-28519594 ACTTATAAGTGGGAGCTGAATGG - Intergenic
1116123546 14:40752515-40752537 ACTTATAAGTGGGAGCTGAATGG - Intergenic
1116188008 14:41623680-41623702 AGTTTTAATTGGAAACTGTAGGG + Intronic
1117729145 14:58703979-58704001 ACTTATAACTGGTGATTGGATGG + Intergenic
1120167443 14:81216744-81216766 AATTATAATTGGAAATTGTATGG - Intronic
1122752066 14:103943915-103943937 ACTGATTATTGTCAACTGGAAGG + Intronic
1124634493 15:31356255-31356277 ACTTATAAGTGAGAACTGGCCGG + Intronic
1127026013 15:54807552-54807574 ATTTCTAAGAGGTAACTGGATGG + Intergenic
1130743992 15:86631042-86631064 ACTGCTACTTGGTACCTGGAAGG + Intronic
1131048594 15:89332117-89332139 ACTTAGAATATGTAACTTGATGG - Intronic
1131215535 15:90532396-90532418 GTTCATAATTGGTAACTGGGTGG + Intronic
1131740060 15:95379593-95379615 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1138892417 16:61160616-61160638 ACTTATATTTTGTAAATGCATGG - Intergenic
1139588146 16:67917522-67917544 ATTTATAAGTGATAACTGGTGGG + Intronic
1144602589 17:16630772-16630794 AGTTATAATTGTTATCTGTATGG - Intronic
1149051232 17:52307947-52307969 ATTTATAATTGATAACTTTATGG + Intergenic
1150855997 17:68753269-68753291 ACTTATAAGTGGGAGCTGGCTGG - Intergenic
1157983869 18:52415249-52415271 TATTATAATTGGTAACAGCAAGG - Intronic
1162891919 19:13739694-13739716 AGCTCTAATTGGTGACTGGAAGG - Intronic
1168212533 19:54900932-54900954 ACTTTTAATGGGTAATTGTATGG + Intergenic
925738569 2:6985462-6985484 ACTGATAATGAGTAAGTGGAAGG + Intronic
926350907 2:11993579-11993601 ATATATGATTGGAAACTGGAGGG + Intergenic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
931112295 2:59124389-59124411 ACTTTAAATTGGTAGCTTGATGG + Intergenic
931796423 2:65714249-65714271 ACATAAAAATGGTAACTGGCAGG - Intergenic
934536878 2:95141444-95141466 CCTAAGAACTGGTAACTGGAAGG + Intronic
938206722 2:129430561-129430583 ACTAAGAAATGGTAACTGTATGG - Intergenic
939313521 2:140516493-140516515 ACCTATTATTGGTATCTGCATGG - Intronic
941875797 2:170431623-170431645 ACTTTTAATTGGTAATTGTCTGG - Intronic
945516360 2:210767624-210767646 ACTTAGAATAGAAAACTGGATGG - Intergenic
945847679 2:214966162-214966184 ACTTATAAGTGGGAGCTGAATGG + Intronic
946978112 2:225175675-225175697 ATTTTTATTTGGTAAATGGAGGG - Intergenic
947112629 2:226735394-226735416 GCTTAAAATTGGTAATTGAATGG - Exonic
1169083309 20:2810982-2811004 ACTTATAAATGGAAGCTGGCGGG - Intergenic
1169481937 20:5990507-5990529 GCTTATAAATGGCAACTAGAGGG - Intronic
1169510151 20:6255349-6255371 GGTTATAATTTGCAACTGGAAGG + Intergenic
1170028338 20:11916053-11916075 ACTATTAATTGGTAGCTGGATGG - Intronic
1172823114 20:37756543-37756565 AGTTATATTTGGAAACTGGGTGG - Intronic
1174415806 20:50366087-50366109 GCTTATCATTGATAACTGGTGGG + Intergenic
1177199709 21:17940535-17940557 GCTTATAAATAGTAACTGGGAGG + Intronic
1177386058 21:20410815-20410837 ACTTAAAATCTGTAAGTGGAAGG - Intergenic
1178942591 21:36918943-36918965 ATGTCTAATTGGAAACTGGAAGG + Intronic
1179556914 21:42184882-42184904 ACTTTTAATTGGTCAGTGGTAGG + Intergenic
1181267530 22:21639487-21639509 AATTATAGTTGGTAGGTGGAGGG + Intergenic
1183450265 22:37890282-37890304 AATTATTATTGGGAACTGAATGG + Intergenic
951231709 3:20186759-20186781 GCTTCTAGTCGGTAACTGGATGG - Intergenic
952087578 3:29844677-29844699 TCATATAATTAGTAAATGGATGG - Intronic
952989842 3:38822133-38822155 ACTCAAAATTGGTAAGTGAAGGG - Intergenic
957509923 3:81174328-81174350 AGTTATTTTTGGTAATTGGAAGG - Intergenic
957980694 3:87506142-87506164 AGTTAAAATTGGTCAATGGATGG + Intergenic
959402517 3:105920794-105920816 ACTTATAAGTGGGAGCTGAATGG - Intergenic
963633653 3:147766133-147766155 ATTTATAATTGGGAAGTGCAGGG + Intergenic
966271558 3:178113351-178113373 TCTTATAATTGGTATTTGCATGG - Intergenic
969320000 4:6405961-6405983 ACTGATAATAGGTAAGTGAAGGG - Intronic
975173258 4:71257809-71257831 ACATATAAATAGTAACTTGATGG + Intronic
976781206 4:88760806-88760828 ACTCATGATTGGTAACTGAGTGG - Intronic
977027804 4:91842534-91842556 CCTTATAAGTGGGAGCTGGAAGG + Intergenic
977393635 4:96445784-96445806 ACTTATAAATGGAAGCTAGATGG - Intergenic
978322146 4:107509342-107509364 ATTTATATTTGGGAACTTGAGGG - Intergenic
978557348 4:109995067-109995089 ACTTATCACCGGTAACTAGAAGG - Intronic
979734604 4:124067076-124067098 ACATATTATTGTTCACTGGATGG + Intergenic
979911185 4:126367665-126367687 ACTTTTAATTATTAACTTGAAGG + Intergenic
981701101 4:147608362-147608384 ACATATAGTTGGTAACTAGCAGG - Intergenic
981728363 4:147871720-147871742 ACTTATAATTGGAAATTGCAAGG + Intronic
982817348 4:159902873-159902895 ACATGTAATTGGGAAATGGAAGG + Intergenic
983358430 4:166696384-166696406 ACTTAGAGTTAGTAAATGGAAGG - Intergenic
984229779 4:177080893-177080915 ACTTATAATGGGTAGATAGATGG - Intergenic
986844140 5:11733228-11733250 ACTTGCAATTGGTATCTGGGGGG + Intronic
987667758 5:20966749-20966771 ACCTATTATTGGAAACTGGTGGG - Intergenic
988579122 5:32453848-32453870 ACTTATAAATGGGGACTGGCTGG - Intergenic
989026916 5:37078260-37078282 ACTTATAAGTGGGAGCTGAATGG - Intergenic
989063986 5:37441129-37441151 ACTTTTAAATTGTAACAGGAGGG + Intronic
991325834 5:65431241-65431263 CTTTATAATTGGTAAAAGGAAGG + Intronic
992509298 5:77417456-77417478 AGTGATAATTGGTACCTGGTAGG + Intronic
993340136 5:86715605-86715627 GCTAAGAATTGCTAACTGGATGG + Intergenic
994417796 5:99496959-99496981 ACTTTTAAATTGTAACAGGAGGG + Intergenic
994462169 5:100078197-100078219 ACTTTTAAATTGTAACAGGAGGG - Intergenic
995298889 5:110554836-110554858 ACTTATTATTGGTCTCTGTAGGG + Intronic
996331986 5:122340127-122340149 ACTTAGAATTGGAAACTCTAGGG + Intronic
996623772 5:125543572-125543594 ACTTATAAATGTTAACTGTATGG + Intergenic
996794378 5:127328671-127328693 ATTTCTAATTGGTAAATGGATGG + Intronic
999553294 5:152714025-152714047 ACATATAGTTTGTAAATGGAAGG + Intergenic
1001514500 5:172345977-172345999 ACTTAAAATTGTAAACTGTATGG + Intronic
1003336145 6:5174697-5174719 ACTTATAATTGGTAACTGGAAGG + Intronic
1004970667 6:20906632-20906654 ACTTATAATTTTTAACTTCATGG - Intronic
1006349054 6:33507570-33507592 ACATATAATTGATAACTAAAAGG - Intergenic
1009528857 6:64783966-64783988 ACTTTTAAATGTTATCTGGAGGG + Intronic
1011477632 6:87763607-87763629 AATTAAAATTGGTTACCGGAGGG + Intergenic
1014878442 6:126690689-126690711 TCCTCTAATTGGGAACTGGAAGG - Intergenic
1019939672 7:4279309-4279331 ACTTTTAATGGGTGACTGTATGG - Intergenic
1020527389 7:9279666-9279688 ACTTTAGATTGGTAAGTGGAGGG - Intergenic
1020918118 7:14224439-14224461 ACTTATAATGGCTAATTTGAAGG + Intronic
1023195722 7:37636561-37636583 ACTTATAAGTGGAAGCTGAATGG - Intergenic
1024020655 7:45364853-45364875 TGTTATGATTTGTAACTGGAAGG + Intergenic
1027504303 7:78996434-78996456 ACTTATAAGTGGGAACTAAATGG + Intronic
1030364778 7:108632900-108632922 ATTTATAATTGTTAAATGTATGG + Intergenic
1037296639 8:17408789-17408811 ACTACTAATGGGTAACTTGATGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042206246 8:66332665-66332687 ACTTATATTTCAAAACTGGAGGG - Intergenic
1043785366 8:84391554-84391576 AATTATAAGTGGTTACTGTAGGG + Intronic
1043961890 8:86426374-86426396 ATTTATAATTGGTTGCTGAAAGG + Intronic
1044081781 8:87894529-87894551 GATGGTAATTGGTAACTGGATGG + Intergenic
1044141691 8:88662304-88662326 ACATATAATTGGATCCTGGATGG + Intergenic
1046248531 8:111599474-111599496 CCTTTTAATTGGTAATTGAATGG + Intergenic
1046840886 8:118855797-118855819 ACTTGTAATTGGTCAATTGAGGG - Intergenic
1047389117 8:124435883-124435905 ATTTATAATGCGGAACTGGATGG - Intergenic
1050642902 9:7687270-7687292 GCTTGTAAGTGGTATCTGGATGG + Intergenic
1052095124 9:24374542-24374564 ACTTAAAATTGGGAAATGGTGGG - Intergenic
1058294469 9:103288140-103288162 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1059934014 9:119289698-119289720 ACTTAGAATGAGTAACTGGTGGG - Intronic
1186605645 X:11087657-11087679 ACTTATAAGTGGTAGCTAAATGG - Intergenic
1188052560 X:25505967-25505989 AATTACAATTGGTAAATGGAAGG - Intergenic
1188693510 X:33159066-33159088 TCTTATAATAGGTTATTGGAAGG - Intronic
1188843278 X:35042307-35042329 ACTTATAAGTGGTAGCTAAATGG + Intergenic
1191823930 X:65343129-65343151 ACTTATTATTGGTCTCTTGAGGG - Intergenic
1193013630 X:76707051-76707073 ACTTATAAGTGGGAACTAAATGG + Intergenic
1193722311 X:85001642-85001664 ACTTATAAGTGGGAACTAAATGG + Intergenic
1195427232 X:104748064-104748086 ATTTACAATTGGTAACTGTGCGG + Intronic
1197573884 X:128183636-128183658 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1197628794 X:128833954-128833976 GCATATATTTGGTAACTGTAGGG - Intergenic
1198085148 X:133275644-133275666 AATTATAACTGGTCACTGTAGGG - Intergenic
1199546615 X:149012989-149013011 AAATATATTTGGTAACTTGAGGG - Intergenic
1199611964 X:149625895-149625917 ACTTACAATTTGTAAATAGAGGG + Intronic
1201911981 Y:19142100-19142122 ACTTTTATTTGGTGAGTGGATGG - Intergenic
1201979975 Y:19896202-19896224 ACTTGTTATTGGTATATGGAGGG - Intergenic