ID: 1003337441

View in Genome Browser
Species Human (GRCh38)
Location 6:5187228-5187250
Sequence CAGGGTGAAGACAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003337441 Original CRISPR CAGGGTGAAGACAGGGTGGC TGG Intronic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900975477 1:6013639-6013661 TAGGGGGAAGACAGGGGTGCAGG - Intronic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901843063 1:11965704-11965726 TGGGGTGAAGGGAGGGTGGCAGG - Intronic
902235353 1:15053819-15053841 CAGGGGCAAGCCAGGTTGGCGGG + Intronic
902280644 1:15371781-15371803 CAGGCTGAAGACAGGGTCCAAGG + Intronic
902292201 1:15442665-15442687 CAGGGTGAGGATGGGGTGTCAGG - Intronic
902328554 1:15718672-15718694 CAGGGTGGGGGCAGGGTGGGCGG + Intronic
902667283 1:17948551-17948573 CAGGGTGAGGGCAGGGGGACAGG - Intergenic
903759414 1:25687404-25687426 CAGGCTGCAGACAAGGGGGCTGG - Intronic
903780078 1:25815365-25815387 CAGGGTGATGAGATGGTGTCGGG + Intronic
904358448 1:29956801-29956823 CATGGTGAAGCCAGGATGGGAGG + Intergenic
904459509 1:30667824-30667846 CAGGATTAACACAGGGTTGCTGG - Intergenic
904612603 1:31733658-31733680 CAGGGAGAAGACAGGGGGCCAGG + Intronic
905409419 1:37757988-37758010 CAGGGTGGAGACAGAGGGGCTGG - Intronic
905452886 1:38068412-38068434 CAGCGTGAAAACAGGAAGGCTGG - Intergenic
905576282 1:39047252-39047274 CAGGAAGAAGCCAGGGTGCCTGG + Intergenic
906652434 1:47522199-47522221 CAGGCTGAGGATGGGGTGGCAGG - Intergenic
907729190 1:57049523-57049545 CAGGGAGGAGACAGGGTGCTTGG + Intronic
908418429 1:63935679-63935701 CAGTGACAAGACAGGGTAGCAGG - Intronic
910562000 1:88600789-88600811 TTGGGTGATGACGGGGTGGCTGG - Intergenic
912554190 1:110504271-110504293 CAGGGGGAGGTCAGGGAGGCTGG + Intergenic
912615794 1:111098448-111098470 CAGGGTGAAGAAATGGTGCCAGG + Intergenic
912733222 1:112128013-112128035 TCGGGTGATGACGGGGTGGCTGG + Intergenic
912754967 1:112316737-112316759 CAACGTGAGGACAGGCTGGCAGG - Intergenic
913139928 1:115931040-115931062 CAGGAGGAAGAGAGAGTGGCGGG - Intergenic
913186674 1:116374806-116374828 CTGGGTGTAGACAGAGTGTCGGG + Intronic
913476926 1:119246550-119246572 AAGTGTGGAGAGAGGGTGGCTGG - Intergenic
914859459 1:151374116-151374138 AAGGGTGAAGGCAGGGTGAGTGG - Intergenic
915486171 1:156222253-156222275 CAGTGGGAAGACAAGGTGGCAGG - Intronic
915667642 1:157459360-157459382 AGGAGAGAAGACAGGGTGGCAGG + Intergenic
915801636 1:158799793-158799815 CTGAGAGAAGAAAGGGTGGCTGG + Intergenic
916378118 1:164178337-164178359 CAGGGTGCAGCCAGGGGAGCCGG - Intergenic
916392307 1:164343786-164343808 GAGGGTGAAGACAGGAATGCTGG + Intergenic
916845826 1:168649197-168649219 CAGGCTCAAGTCAGAGTGGCTGG - Intergenic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
920071633 1:203306585-203306607 CAGAGGGAACACAGGGTGGGAGG + Intronic
921589008 1:216981861-216981883 CATGGTGAGAACAGGGTGCCAGG - Intronic
921986362 1:221317206-221317228 GAGAGGGAAGGCAGGGTGGCAGG - Intergenic
922808008 1:228400539-228400561 CGGGGTGAAGACAGAGTGAAGGG + Intronic
922980594 1:229823248-229823270 CAGGGTGAGGACAGGTGGCCAGG + Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
924109801 1:240687457-240687479 CAGGGTGAGGAAAGGATGACAGG + Intergenic
924367714 1:243313571-243313593 CAGGGTTAACACAGTGTTGCTGG + Intronic
924384013 1:243486597-243486619 GAAGGTGGAGCCAGGGTGGCCGG + Intronic
924829607 1:247579190-247579212 CTGTGTGATGACGGGGTGGCTGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062903831 10:1166402-1166424 CTGGCTGAAGTCAGGGTGGCTGG - Intergenic
1062917575 10:1253627-1253649 CAGGGAGAAGGCAGCATGGCAGG + Intronic
1063423052 10:5928995-5929017 CAGGGTGCAGGCAGGGTGGGCGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064011561 10:11740560-11740582 CAGGATGAAGACACGGTTCCCGG - Intergenic
1064336481 10:14448067-14448089 CTGGGTGCCGACTGGGTGGCAGG - Intronic
1065167682 10:22997264-22997286 CAAGATGAAGCCAGGGTGGAAGG - Intronic
1065644065 10:27816188-27816210 CAGGGACAAGACAGGGTGCAGGG - Intronic
1066444504 10:35469682-35469704 CAGGGAGAAGACAGGGAGATAGG + Intronic
1067036934 10:42927734-42927756 CAGAGAGAAGACAGGCTGGGAGG - Intergenic
1067458608 10:46441074-46441096 CAGGATGAACACAGGAGGGCTGG + Intergenic
1067556956 10:47279270-47279292 CAAGGTGAGGACAGAGGGGCAGG - Intergenic
1067628588 10:47943562-47943584 CAGGATGAACACAGGAGGGCTGG - Intergenic
1067783135 10:49223451-49223473 GAGGCTGGAGACAGGGTGGCTGG + Intergenic
1068007643 10:51409291-51409313 GGGAGAGAAGACAGGGTGGCAGG + Intronic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1069665774 10:70156690-70156712 CAAGGTAAAGACTGCGTGGCAGG + Intronic
1069897861 10:71689925-71689947 CAGGGTCTGGACAGGGTGGCTGG + Intronic
1069993501 10:72329002-72329024 CAGGCTGCAGTCAGGGTGGGAGG + Intergenic
1070290321 10:75109573-75109595 CAGGGTGCAGAGGAGGTGGCTGG + Intronic
1070627828 10:78063674-78063696 CAGGGTGAGGGCAGAGGGGCTGG - Intergenic
1071431383 10:85609653-85609675 CTGGCTGAGGCCAGGGTGGCCGG - Intronic
1072451332 10:95541685-95541707 CAGGGTGAAACCAGCTTGGCAGG - Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072951265 10:99848546-99848568 CCAGGTGAAGCCAGAGTGGCTGG - Intronic
1073378736 10:103060773-103060795 AAGGTTGAAAACAGGGTGGAAGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1075743868 10:124712885-124712907 CTGGGTGCAGACACGGTGGCAGG + Intronic
1075846279 10:125547259-125547281 CAGGAGGAAAAAAGGGTGGCTGG + Intergenic
1076160855 10:128243159-128243181 CAGCGACAAGACAGGGTGGGTGG - Intergenic
1076349770 10:129807998-129808020 CAGGGAGGAGAAAGGGAGGCAGG - Intergenic
1076512402 10:131022042-131022064 CATGGTGGAGAGAAGGTGGCTGG + Intergenic
1076747442 10:132521521-132521543 CAGGGTGCAGCCAGGGTGTGGGG - Intergenic
1076806688 10:132862421-132862443 CAGGGAGAGGACAGGGTGGGTGG + Intronic
1076904955 10:133357056-133357078 AAGGGTGCAGACAGGCAGGCGGG - Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078106594 11:8361749-8361771 AAGGGTCAGGACAGGATGGCAGG + Intergenic
1078744308 11:14096624-14096646 AAGCTGGAAGACAGGGTGGCTGG - Intronic
1079113382 11:17621551-17621573 CAGGGTCAGGACAGGGTTGGAGG + Intronic
1079957100 11:26879197-26879219 GAGGCTGAAGCCAGAGTGGCTGG + Intergenic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080681725 11:34483086-34483108 GAGCCTGAAGCCAGGGTGGCTGG - Intronic
1081281000 11:41209317-41209339 CAGAAAGAAGAAAGGGTGGCAGG - Intronic
1083088092 11:60170704-60170726 GGTGGTGAAGACATGGTGGCAGG + Intergenic
1083662731 11:64259261-64259283 TAGGGTCAAGTCAGGGTGGCGGG - Intronic
1083949854 11:65947880-65947902 CAGGGAGCAGTCAGGGAGGCAGG + Intronic
1084061467 11:66678022-66678044 CAGGGTGGTGACTGGCTGGCTGG - Intergenic
1085048577 11:73367807-73367829 CAGGCTGAAGGCAGGTGGGCGGG - Exonic
1085274841 11:75291843-75291865 CTGGGGGAGGACTGGGTGGCAGG - Intronic
1085320668 11:75572089-75572111 CAGGGTGCACACAGGATGGCAGG + Exonic
1085409903 11:76284693-76284715 CAGGGTGAAGACAGCAGGGCGGG + Intergenic
1085611997 11:77958900-77958922 CAAAGTGAAGATAGGGTGGTTGG + Intronic
1086783081 11:90931215-90931237 CAGTGTGCAGGCAGGGTGCCTGG - Intergenic
1087374122 11:97321340-97321362 TTGGATGATGACAGGGTGGCTGG - Intergenic
1088097235 11:106115419-106115441 TGGGGAGAAGGCAGGGTGGCAGG - Intergenic
1088191626 11:107234229-107234251 GGGGGAGAAGGCAGGGTGGCAGG + Intergenic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1088877423 11:113947505-113947527 CAAGGTGCAAACAGGGTGGGTGG + Intergenic
1088995605 11:114993659-114993681 CAGTGAGATGACAGGATGGCTGG - Intergenic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089681635 11:120121955-120121977 CAGGGAGGAGGCAGGCTGGCCGG + Intronic
1089741887 11:120590210-120590232 CAAGGTGAAGGCAGGGTGTCAGG - Intronic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090457240 11:126860709-126860731 CAGGGTGGAGAATGGGTGGCAGG + Intronic
1092192941 12:6533674-6533696 CAGGCGGAGGACAGGATGGCTGG - Intergenic
1092386379 12:8038647-8038669 CAGGGTCTAGAAAGGCTGGCAGG - Intronic
1094389755 12:29935958-29935980 GCGAGAGAAGACAGGGTGGCAGG + Intergenic
1094410475 12:30163364-30163386 CAGGGTGGAGACGGGGAGGTGGG - Intergenic
1095311692 12:40705864-40705886 CAGGATCAAGAGAGAGTGGCGGG + Intronic
1096180942 12:49549998-49550020 CAGGGTGGAGAGGGGCTGGCTGG + Intronic
1098347769 12:69524272-69524294 CAGGGTGCAGACACCCTGGCTGG + Intronic
1098364747 12:69690521-69690543 CAGGAAGAAGCCAGGTTGGCTGG - Intronic
1098551734 12:71770075-71770097 CAGAGAGAGGACAGGGTGGGTGG + Intronic
1098908493 12:76185860-76185882 GGGGGTGAAGAGAAGGTGGCAGG - Intergenic
1099227212 12:79983594-79983616 TAGGGTGAAGAAAGGGAGTCTGG + Intergenic
1099516951 12:83608693-83608715 TAGGGTGAAGACTGGGAGGGGGG + Intergenic
1099681567 12:85836275-85836297 CAGGGTGAAGGGAGGAGGGCTGG + Exonic
1100472173 12:94903314-94903336 CAGGGTGACGACTGGAAGGCTGG + Intronic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1103427979 12:120855090-120855112 CAAGGAGAAGAAACGGTGGCTGG - Intronic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103846893 12:123908094-123908116 CAGGGAGGAGACAGGGAGACAGG - Intronic
1103846904 12:123908151-123908173 CAGGGAGGAGACAGGGAGACAGG - Intronic
1104125168 12:125839280-125839302 AAGGGAGAAGACTGGGTGGATGG + Intergenic
1104164594 12:126215532-126215554 CAGGCAGCAGACAGGATGGCTGG + Intergenic
1104588593 12:130066911-130066933 CAGAGGGAAGGCTGGGTGGCGGG - Intergenic
1105587277 13:21756858-21756880 CAGGGTGAAGTCAGGGGGCAGGG - Intergenic
1105826273 13:24126190-24126212 CAGGATGAAGTCATGGGGGCAGG + Intronic
1106907442 13:34423528-34423550 CAAGGTGGAGACATGTTGGCTGG + Intergenic
1107315423 13:39126424-39126446 CAGGGAGAAGAGAGGTAGGCAGG + Intergenic
1107401974 13:40077970-40077992 CAGGTAGAAGAGAGGGAGGCAGG + Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1107972365 13:45655593-45655615 AAGAGTGAAGACAGGGTATCTGG - Intergenic
1108288701 13:48935544-48935566 CAGAATGATGACAGGGTGGCAGG - Intergenic
1110074204 13:71218021-71218043 CAGCAGGAAGCCAGGGTGGCTGG - Intergenic
1112059798 13:95727025-95727047 CAGGCTGAAGACTGGGTGGTGGG + Intronic
1113567008 13:111325262-111325284 CAGAGTCATGACAGCGTGGCTGG - Intronic
1113888658 13:113725097-113725119 CAGGGTGCAGGCTGGGAGGCCGG + Intronic
1113963659 13:114139686-114139708 GTGGGTGTAGACAGGGTGGTGGG + Intergenic
1113963712 13:114139920-114139942 GTGGGTGTAGACAGGGTGGTGGG + Intergenic
1114538741 14:23439343-23439365 CAGGCTGCAGACAGGAGGGCCGG + Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1115505562 14:34090649-34090671 CAGAGGGGAAACAGGGTGGCTGG - Intronic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116056478 14:39870609-39870631 CAGGGCAAGGACAGAGTGGCAGG + Intergenic
1116282616 14:42928405-42928427 CAGTGTGAAGACACATTGGCTGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117588384 14:57238465-57238487 TAGGATGAAGACAGGGTAGGGGG + Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1118488744 14:66238596-66238618 CATGGGGAAGACTGGGTGTCAGG - Intergenic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1120231403 14:81844989-81845011 GAGAGAGAAGGCAGGGTGGCAGG + Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1122815620 14:104310709-104310731 CAGGGCTATGGCAGGGTGGCAGG + Intergenic
1122815630 14:104310748-104310770 CAGGGCTATGGCAGGGTGGCAGG + Intergenic
1122894001 14:104746403-104746425 CAGGGTGCAGGGAGGGTGGCTGG - Intronic
1123079457 14:105685440-105685462 CAGGGTGCAGCCCGGGTGACAGG - Intergenic
1202943071 14_KI270726v1_random:1211-1233 CAGGGTGAGGGCAGAGCGGCAGG + Intergenic
1124193690 15:27601588-27601610 GAGGAGGAAGACAGGGTGCCCGG + Intergenic
1124395255 15:29295041-29295063 GAGGGAGAAAACAGGGTGACAGG + Intronic
1125476040 15:40048685-40048707 CAGGGTGCAGCCAGGGTAGGGGG - Intergenic
1127172974 15:56322855-56322877 CATGTTGAAGACAAGGTGGTGGG + Intronic
1127356941 15:58209450-58209472 GAGAGAGAAGGCAGGGTGGCAGG - Intronic
1127762127 15:62149833-62149855 CAGGGAGGAGACAGGAAGGCAGG + Intergenic
1128092578 15:64928937-64928959 CAGGGTGTAGAGACCGTGGCAGG - Intronic
1128967769 15:72077626-72077648 CAGGGTGGTGGCAGGGTGGCGGG + Intronic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1129519763 15:76178252-76178274 CAGGGTGGAGACAGGAAGACTGG + Intronic
1129703768 15:77782983-77783005 CAGGAGGAAGACAGTGTGGCTGG - Intronic
1130205010 15:81867688-81867710 CATGGTGCAGAGAGGGTGGTTGG + Intergenic
1130388794 15:83436523-83436545 CAAGGTGATGACAGTGTTGCTGG - Intergenic
1130949318 15:88573180-88573202 AAGGGAGAGGACAGGGTGCCAGG - Intergenic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131410923 15:92207829-92207851 CAGGCTAAAGACATGGTGTCAGG + Intergenic
1131965829 15:97841140-97841162 GATGTTGAAGACAGGGTGACGGG - Intergenic
1132771401 16:1565445-1565467 CAGGGGGAATCCAGGGGGGCTGG + Intronic
1133111231 16:3549436-3549458 CAGGGAGAGGACAGGATGACAGG + Intronic
1133339900 16:5029335-5029357 GAGGGGGATGAGAGGGTGGCCGG + Intronic
1134220891 16:12353078-12353100 CGGAGAGAAGACAGGGTGTCAGG - Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135732513 16:24906842-24906864 CAGGGTCAAGAAAGGAGGGCTGG + Intronic
1135938244 16:26799019-26799041 CAGGGACTAGACAGGGTGCCAGG - Intergenic
1136071547 16:27790715-27790737 CAGGCTGGACACAGGCTGGCAGG - Exonic
1136706255 16:32190317-32190339 CAGGGTGAAGTCAGGTTTGTTGG - Intergenic
1136761655 16:32739094-32739116 CAGGGTGAAGTCAGGTTTGTTGG + Intergenic
1136806445 16:33131296-33131318 CAGGGTGAAGTCAGGTTTGTTGG - Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138161439 16:54758528-54758550 CTGGGTGGACACAGGCTGGCTGG + Intergenic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138583295 16:57955376-57955398 AAAGGAGAAGACAGGGTGGGTGG + Intronic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1140479147 16:75253222-75253244 CAGGCTGAGGAGTGGGTGGCTGG - Intronic
1141073074 16:80975872-80975894 CATGGTGAAGTCAGGTTTGCTGG + Exonic
1141182462 16:81763547-81763569 CATGGTGAGGTCAGGGTAGCTGG + Intronic
1141224264 16:82100439-82100461 CAGGAGGAAGAGAGAGTGGCGGG + Intergenic
1141953385 16:87353639-87353661 CAGGTTCAAGACACGGTGTCCGG - Intronic
1141953407 16:87353725-87353747 CAGGTTCAAGACAAGGTGTCTGG - Intronic
1203063812 16_KI270728v1_random:999407-999429 CAGGGTGAAGTCAGGTTTGTTGG + Intergenic
1142558042 17:793011-793033 CAGGATGTAGCCAGGGTGTCAGG + Intergenic
1142697788 17:1643316-1643338 CGGGGCGAAGACAGGTGGGCGGG - Intronic
1142697802 17:1643353-1643375 CGGGGCGGAGACAGGGGGGCGGG - Intronic
1143116157 17:4582885-4582907 CCGGGAGAAGGCAGGCTGGCTGG - Intergenic
1143612303 17:8025731-8025753 CTGGGGCAAGACAGGGTGGCAGG + Intergenic
1143731275 17:8884358-8884380 CAGGGAGAAGCCAGGGTCTCGGG - Intronic
1144050797 17:11495706-11495728 CAGAGGGATGGCAGGGTGGCCGG - Intronic
1144232346 17:13220700-13220722 CAGGGTGAAGGCAAGGTAGATGG + Intergenic
1144596128 17:16571582-16571604 CAAGTTGAAGACAGGGGGCCAGG - Intergenic
1144857202 17:18275991-18276013 CAGTGTGAAGGGAGGCTGGCTGG - Intronic
1144945346 17:18966880-18966902 CAGGGTGCCGGCAGGGTGGAGGG + Intronic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1146004981 17:29155419-29155441 CAGGGTCCACACAGGGCGGCAGG - Intronic
1146403385 17:32517966-32517988 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403394 17:32518003-32518025 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403403 17:32518040-32518062 GAGGGTGATGGCAGAGTGGCGGG - Intronic
1146403412 17:32518077-32518099 GAGGGTGATGGCAGAGTGGCAGG - Intronic
1146403420 17:32518114-32518136 GAGGGTGATGACAGAGTGGCAGG - Intronic
1146405521 17:32533489-32533511 CAGCTTGAAGAGTGGGTGGCAGG - Intronic
1146537315 17:33663990-33664012 CAGGATGAAGACAGGCTGAAAGG - Intronic
1146793402 17:35765428-35765450 GAGGCAGAAGACAGGGAGGCTGG + Intronic
1146795111 17:35775040-35775062 CAGGCAGAAGAGGGGGTGGCGGG + Intronic
1146816222 17:35944325-35944347 CAGGGAGGGGACAGGGTGTCAGG - Intergenic
1147371820 17:39997720-39997742 CTGGGGGAGGTCAGGGTGGCTGG - Exonic
1147492599 17:40884295-40884317 CTGGGTGGAAACAGTGTGGCAGG - Intronic
1147877669 17:43632847-43632869 CAGGATGAAGGGAGGGTGGACGG + Intergenic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148050247 17:44766606-44766628 CAGGGTCATGGCTGGGTGGCTGG - Intronic
1148216241 17:45835389-45835411 CAGGGTGAAGGCAGCAAGGCAGG - Exonic
1148507157 17:48136506-48136528 TAGGTTGCAGACAGGATGGCTGG + Intronic
1149515813 17:57280125-57280147 CTGAGGGAAGAGAGGGTGGCTGG + Intronic
1149523807 17:57338805-57338827 GTAGGTGAAGACAGGGAGGCAGG - Intronic
1150166917 17:62952721-62952743 CAGGGTGAGGCCAATGTGGCTGG - Intergenic
1151950796 17:77352600-77352622 CAGGGTGAAGGCCAGGTGGGGGG - Intronic
1152108118 17:78342350-78342372 CAGGGCGCAGACCGGGCGGCGGG - Intergenic
1152239858 17:79155603-79155625 CAGGGTGAAGACGAAGTGGGTGG + Intronic
1152336930 17:79703878-79703900 CAGGGAGAAAGCAGAGTGGCTGG + Intergenic
1152527271 17:80895515-80895537 CTGGGTGTGGACAGGGTGGGAGG - Intronic
1152583721 17:81180097-81180119 CGGGCTGGAGACAGGGTGGGAGG - Intergenic
1152588751 17:81200766-81200788 CAGCGTGAATACTGGATGGCGGG + Intronic
1153089740 18:1330419-1330441 GGGAGAGAAGACAGGGTGGCAGG - Intergenic
1153694565 18:7627195-7627217 CAGAGTAATGACAGGGTGGCTGG - Intronic
1154041992 18:10865156-10865178 CAGGGTGAGGACATGAAGGCAGG + Intronic
1154252641 18:12757017-12757039 AGGAGAGAAGACAGGGTGGCAGG + Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1156303891 18:35858952-35858974 CAGAGAGAAGGCAGGGTGGCAGG - Intergenic
1157223340 18:45842164-45842186 CACGGTGAGCACATGGTGGCTGG - Exonic
1157247867 18:46070331-46070353 CAGGGTGAAGACAGGGTTCCAGG - Intronic
1158044157 18:53135122-53135144 AAGGGTGCAGAGAGGGTGTCTGG - Intronic
1158886981 18:61837939-61837961 CTTGGTGAAGACAGGAGGGCAGG - Intronic
1158930943 18:62325045-62325067 CGGGCTGCAGACAGGTTGGCGGG - Intergenic
1159898118 18:74016179-74016201 CAGGTTGAAGACAGCTGGGCAGG - Intergenic
1160092492 18:75840269-75840291 AAGAGAGAAGGCAGGGTGGCAGG - Intergenic
1161302822 19:3551249-3551271 CAGGGTGAGGACATGGAGGGAGG + Intronic
1161626652 19:5330830-5330852 CAGGGTGCAGAGAGGCTGCCAGG - Intronic
1162057176 19:8071685-8071707 CAGGGTGCAGGCAGGGTTGGAGG + Intronic
1162520692 19:11177874-11177896 CAAGGTGAAGAGAGGGTGTGGGG - Intronic
1163076137 19:14893419-14893441 CATAATGAAGACAGGGTGGAGGG + Intergenic
1163484906 19:17579858-17579880 CTGGGTGTGGTCAGGGTGGCAGG + Intronic
1163980845 19:20898546-20898568 CAGTGTGATGACTGAGTGGCTGG - Intergenic
1164776502 19:30857460-30857482 TAGGGTGTAGTCAGGGAGGCTGG - Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1164926153 19:32131597-32131619 CCTGGTGAACACAGGGTGCCCGG + Intergenic
1165060811 19:33204451-33204473 CAGTGTGGGGACAGAGTGGCTGG + Intronic
1165255512 19:34575420-34575442 CAGGGTGCAGACTGGAAGGCTGG + Intergenic
1165735748 19:38174376-38174398 CAGGGTGAAGGCCAAGTGGCTGG + Intronic
1166043419 19:40216191-40216213 CAGCGGGAAGACAGTGGGGCTGG - Exonic
1166872919 19:45882004-45882026 CAGGGTGGGGCCAGGGTGGAGGG - Intergenic
1166977142 19:46611297-46611319 CCGGGTGAAGAGAGGAAGGCAGG + Intergenic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1168073558 19:53965969-53965991 CAGTGTGAGGTCAGCGTGGCCGG + Intronic
926037916 2:9649479-9649501 AAGAGTGAAGACAGGCTGGGAGG - Intergenic
926192526 2:10739484-10739506 CAGGATGGAGCCAGGGTGGCTGG - Intronic
926751310 2:16200827-16200849 CAGTGTGAAGAAAATGTGGCTGG - Intergenic
927131170 2:20061965-20061987 AAGGCTGAAGACTGGCTGGCTGG + Intergenic
927132837 2:20074982-20075004 CAGGATGGAGGCAGGGTGGCTGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927804620 2:26135745-26135767 CAAGGAGAAGAAATGGTGGCAGG - Exonic
927861150 2:26561057-26561079 CAGGTGGAAGGCAGGGTGGTGGG + Intergenic
927888190 2:26731138-26731160 CAGTGTGAAGACAGATAGGCAGG - Exonic
929143661 2:38687890-38687912 CAGGGTTAGGACAGGTTAGCTGG - Intronic
929546232 2:42856713-42856735 CAGGGTGGTTACAGGGTGGAGGG - Intergenic
929792530 2:45034210-45034232 CAAGGTGAAGAGAGGGCTGCAGG + Intergenic
930418699 2:51121770-51121792 TTGGGTGATGACAGGGTGGCTGG - Intergenic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
930700997 2:54457248-54457270 CCTGTTGAAGAGAGGGTGGCAGG - Intronic
931381263 2:61755648-61755670 CAAGGTGAAGAAAGGGTCTCAGG - Intergenic
932020205 2:68076985-68077007 AAGGCTGAAGTCAGGGTGGAGGG + Intronic
933205697 2:79504980-79505002 CTGGGAGAAGACAGGAAGGCAGG + Intronic
933831185 2:86210307-86210329 CCGGGGGAAGGGAGGGTGGCGGG - Intronic
933917902 2:87014868-87014890 CTCGGTGAAGGCAGTGTGGCTGG + Intronic
934005093 2:87755046-87755068 CTCGGTGAAGGCAGTGTGGCTGG - Intronic
934112446 2:88756332-88756354 CAGGGAGGAGGCAGGGTGGTGGG - Intergenic
934608103 2:95713372-95713394 TAGGGTGGGGACAGTGTGGCAGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935601337 2:104925192-104925214 CAAAGTGAAGACAGGATTGCTGG - Intergenic
935768054 2:106389138-106389160 CTCGGTGAAGGCAGTGTGGCTGG - Intergenic
936163661 2:110102793-110102815 CAGGGAGGAGGCAGGGTGGTGGG - Intronic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936541440 2:113355259-113355281 TAGGGTGGGGACAGTGTGGCAGG - Intergenic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937257098 2:120563395-120563417 CAGGATGAGGGCAGGATGGCTGG + Intergenic
937756313 2:125542901-125542923 CAATGTGAAGACAGGAAGGCTGG - Intergenic
937785093 2:125886935-125886957 TTGGGCGATGACAGGGTGGCTGG + Intergenic
939788573 2:146545324-146545346 TTGGGTGATGACAGGGTAGCTGG + Intergenic
940985842 2:160051402-160051424 CAGAGTCAAGACAGGCTGCCGGG - Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
942121601 2:172783223-172783245 CAGAGTGAGGACAGAGTGGTCGG + Intronic
942297014 2:174527575-174527597 CAGAGGGAGGCCAGGGTGGCTGG + Intergenic
942328867 2:174800637-174800659 CAGAGTGAAGGGAGGGTGGGTGG - Intronic
942602708 2:177657870-177657892 CAGGGTGAAGAGAAAGTAGCTGG + Intronic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
946143030 2:217707421-217707443 GAAAGTGGAGACAGGGTGGCAGG + Intronic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
947545855 2:231009680-231009702 CAGGATGAAGACAGGGACTCCGG - Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948815943 2:240510343-240510365 CAGGGAGGAGTCAGGGAGGCGGG - Intronic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1170573259 20:17644488-17644510 GAGGGGGAAGACAGGAAGGCTGG - Intronic
1170730420 20:18970113-18970135 CAGGCTGAAATCAAGGTGGCTGG + Intergenic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1172099431 20:32476317-32476339 GAGGGGGAAGAGAGGCTGGCAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172271759 20:33659158-33659180 GAGGATGGAGACAGGGAGGCTGG - Intronic
1172449768 20:35013771-35013793 CAGGGACTAGACAGGGTGTCAGG + Intronic
1172487524 20:35307286-35307308 AAGAGTGAAGACAAGGTAGCTGG - Intronic
1172611635 20:36256747-36256769 CAGTTTGATGTCAGGGTGGCAGG - Exonic
1174466695 20:50723295-50723317 CAAGGTGAGGACAGTGAGGCAGG - Intergenic
1174700994 20:52609297-52609319 ATGGGTGAAGTCAGGGTGGGAGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175274825 20:57761148-57761170 CACTGTGAGGCCAGGGTGGCAGG - Intergenic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175746314 20:61459665-61459687 CAGGGTGAAGACAGGGTCCCTGG - Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1176366990 21:6039286-6039308 CAGGGTGAGGACAGGGGACCAGG - Intergenic
1176998192 21:15580444-15580466 GAGAGAGAAGGCAGGGTGGCAGG - Intergenic
1177139386 21:17342005-17342027 GAGAGAGAAGGCAGGGTGGCTGG + Intergenic
1177206573 21:18017440-18017462 AAGGCTGAAGCCAGAGTGGCTGG - Intronic
1177973273 21:27816839-27816861 CAGGTGGAAGACAGGGTGAAGGG + Intergenic
1179163239 21:38914947-38914969 AAGGAGGAAGAGAGGGTGGCCGG + Intergenic
1179732277 21:43374547-43374569 CAGAGTGCGGGCAGGGTGGCGGG - Intergenic
1179756528 21:43499260-43499282 CAGGGTGAGGACAGGGGACCAGG + Intergenic
1180009489 21:45040261-45040283 CAGGCAGGAGAGAGGGTGGCGGG + Intergenic
1180041618 21:45283211-45283233 GGGGGTGAAGACACCGTGGCGGG + Intronic
1180800936 22:18631543-18631565 CATAGAGAAGACAGGTTGGCAGG - Intergenic
1180843316 22:18969301-18969323 CAGGGTGGAGCCATGCTGGCCGG - Intergenic
1180852169 22:19027100-19027122 CATAGAGAAGACAGGTTGGCAGG - Intergenic
1180947232 22:19702970-19702992 CAGATTGCAGACAGGGAGGCAGG + Intergenic
1181220782 22:21363719-21363741 CATAGAGAAGACAGGTTGGCAGG + Intergenic
1181313345 22:21957201-21957223 CAGGGAGAAGGCAGGGTCGAGGG - Exonic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181346450 22:22223273-22223295 CAGGGAGAAGGCAGGGTCGAGGG - Intergenic
1181494209 22:23278823-23278845 AGGGGTGAAGACAGGATGGGTGG + Intronic
1182101885 22:27663228-27663250 CAGGGTGAAGGCCTGGAGGCTGG - Intergenic
1182740245 22:32562316-32562338 CAGGCTGAGGACAGGGCAGCGGG + Intronic
1183675573 22:39297214-39297236 CAGCGTGGAGACAGGGCGGGAGG + Intergenic
1184218083 22:43080607-43080629 CAGGGTGCACACAGGCTTGCAGG - Intronic
1184468475 22:44682554-44682576 CCTGGTGAAGACATGGAGGCCGG + Intronic
1184927246 22:47651477-47651499 CAGGGCAAGAACAGGGTGGCAGG + Intergenic
1184967657 22:47992831-47992853 CAGGCTGAAGAGAGGATTGCAGG - Intergenic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
949961296 3:9314652-9314674 CAGGGTGGAGAGAGGAGGGCAGG - Intronic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950520498 3:13495133-13495155 CCAGGTGGAGAGAGGGTGGCTGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951483535 3:23186862-23186884 GATGGTGAAGACAGGCTGCCTGG - Intergenic
953056575 3:39392251-39392273 CGGGGTGAGGATAGGGTGGGTGG + Intronic
953415146 3:42711543-42711565 CAGGGAGGAGGCAGGGAGGCTGG - Intronic
953734392 3:45479348-45479370 CAGGGTGATGCTAGAGTGGCAGG + Intronic
953770086 3:45772881-45772903 CAGGTTGAAGGGAGGGTGGAAGG - Intronic
954054188 3:48008224-48008246 GAGAGAGAAGGCAGGGTGGCAGG - Intronic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954275526 3:49539545-49539567 CAGCATGAAGACCGGGTTGCTGG + Intergenic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954708044 3:52491530-52491552 CAGGCTGCAGACAGGCTGCCTGG + Intronic
956050102 3:65238605-65238627 TGGGGTGAAGACAGGGAGGGAGG - Intergenic
956606595 3:71079106-71079128 CAGGGGCAAGACAGAGTGGGTGG - Intronic
956747943 3:72324253-72324275 GAGTGTGGAGACAGGGTGGGAGG - Intergenic
957754624 3:84469685-84469707 CAAAGAGAAGGCAGGGTGGCAGG - Intergenic
959400881 3:105900804-105900826 AAAGATGAAGACTGGGTGGCAGG + Intergenic
959531630 3:107440298-107440320 CAGAGTGAGGCCAGAGTGGCTGG + Intergenic
961521504 3:127469763-127469785 CAGGGTGGAGGCAGGGTGTGGGG - Intergenic
961710949 3:128827753-128827775 GAGAGAGAAGGCAGGGTGGCAGG + Intergenic
962457126 3:135574881-135574903 AAGGGTGAAGACACTGTGGAAGG - Intergenic
962578098 3:136772973-136772995 CAGGGTGCAGACGGGGTGCAGGG + Intergenic
963601695 3:147384590-147384612 CAGAGAAAAGACAGGGTGCCCGG - Intergenic
967189755 3:186975155-186975177 CAGGGTGAATCCAGGGAAGCGGG + Intronic
968001941 3:195212252-195212274 CAGGCTGAAGCCAGGGCTGCTGG + Intronic
968083610 3:195863917-195863939 CCGGGTGAAGACAGGCTTGAGGG - Exonic
968623133 4:1613316-1613338 CAGGGTGAGGACCCGGTGACAGG - Intergenic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
969036929 4:4261922-4261944 CTGGGTGAAAATAGAGTGGCAGG + Intergenic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
970899515 4:21142664-21142686 CAAGGTGAAGAGATGCTGGCAGG - Intronic
971979270 4:33732614-33732636 GAGAGAGAAGGCAGGGTGGCAGG + Intergenic
972189609 4:36574453-36574475 CTGAGGGTAGACAGGGTGGCTGG - Intergenic
972202992 4:36737824-36737846 CAGGGTTCAGACAGAATGGCAGG + Intergenic
972259239 4:37391797-37391819 CTGGGGGAAGACAGCGGGGCAGG - Intronic
973102951 4:46295007-46295029 CAGAGAGAAGGCAGGGTAGCAGG - Intronic
973620740 4:52722760-52722782 CAGGGAGAAGGCAGCGTCGCAGG + Intronic
974478952 4:62420099-62420121 CTGGGTGATGATGGGGTGGCTGG + Intergenic
976332280 4:83846370-83846392 AAGGATGAACACAGGGTGGCAGG - Intergenic
976388537 4:84485750-84485772 CAGAGTGAAGCCAGGGTACCAGG - Intergenic
977204739 4:94155896-94155918 CGGAGAGAAGGCAGGGTGGCAGG - Intergenic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978735216 4:112077113-112077135 CAGGGTGAGGCCAGGGTGTGAGG + Intergenic
978899044 4:113926559-113926581 TAGGAGGAAGGCAGGGTGGCAGG + Intronic
979881310 4:125963308-125963330 AAGGGTGATGACAGGGTATCTGG + Intergenic
980460240 4:133101134-133101156 CAAGGAGAAGACAAGGTAGCTGG + Intergenic
980906091 4:138950077-138950099 CAGGCTGCAGCCAGGGTAGCTGG - Intergenic
980973632 4:139589612-139589634 CAGGGTGGTGATAGGGTGGTGGG + Intronic
981552145 4:145952870-145952892 CAGGGTGGAGGGATGGTGGCAGG - Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982639925 4:157945452-157945474 CATGGAGAAGCCATGGTGGCAGG + Intergenic
982922970 4:161299462-161299484 AAGAGTGAAGAGAGGTTGGCAGG - Intergenic
983252513 4:165360761-165360783 AATAGTGAAGACAGGGTGGCAGG - Intergenic
983624846 4:169792012-169792034 AAAGATGAAGCCAGGGTGGCCGG + Intergenic
984872180 4:184335563-184335585 CAGGCTGAAGACAGGATGCAAGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985218781 4:187680955-187680977 CAGGGTGAAGAGCGGCTGGGAGG - Intergenic
985484246 5:139975-139997 CAGGGTGAGGTCAGGGTGTCGGG - Intergenic
985815541 5:2125384-2125406 CAGGAGGAAGGCAGGCTGGCTGG + Intergenic
987466235 5:18275318-18275340 GAGAGAGAAGTCAGGGTGGCAGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
988850396 5:35174737-35174759 AAGGGTAAAGTCAAGGTGGCTGG - Intronic
991036765 5:62135207-62135229 AAGGGTGAAGCCAGGGAAGCGGG + Intergenic
991594550 5:68289029-68289051 CAGGGAGAAGGCAGGGAGACAGG - Intronic
991962415 5:72058389-72058411 CAGGCAGAAGGAAGGGTGGCTGG - Intergenic
994997588 5:107083697-107083719 CAAGATGAATTCAGGGTGGCAGG - Intergenic
997260312 5:132460631-132460653 CACGGGGAAGGCAGGATGGCAGG - Exonic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
998141967 5:139705096-139705118 CAGGGTGCTGACAGCCTGGCAGG - Intergenic
998207210 5:140166434-140166456 TAGGGTGCAGACAGGGAGGCAGG + Intergenic
999282097 5:150372639-150372661 CAAGGGCAAGACAGGGGGGCTGG + Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999475907 5:151898712-151898734 CAGATTGAAGACAGGGAGGTGGG + Intronic
1000223230 5:159234098-159234120 GGGAGAGAAGACAGGGTGGCAGG + Intergenic
1001311349 5:170613103-170613125 CCAGGTGGAGACAGGGTGGAAGG - Intronic
1002478978 5:179486825-179486847 CACGGTGAAGAGGGGGCGGCAGG - Intergenic
1002904730 6:1438987-1439009 CAGGGTAAAGGCTGGGTGGGGGG - Intergenic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1005123164 6:22413379-22413401 CAGGGTGAAGGCATGGAGGGTGG + Intergenic
1005275227 6:24210079-24210101 GAGGGTGAAGACAGACAGGCAGG - Intronic
1006409015 6:33861550-33861572 CAGGTGGAAGACAGGTTGGGTGG + Intergenic
1006439849 6:34047239-34047261 CAGGCTGCAGACAGGATGGAGGG - Intronic
1007293092 6:40801801-40801823 CTAAGTGAAGAGAGGGTGGCAGG + Intergenic
1007521197 6:42452664-42452686 CGGGGAGAAGGCAGCGTGGCCGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1010107975 6:72190652-72190674 GGGGGAGAAGGCAGGGTGGCAGG + Intronic
1010818660 6:80388668-80388690 GAGAGAGAAGGCAGGGTGGCAGG - Intergenic
1011398852 6:86937980-86938002 CAGGGTGCAGGCACGGTGCCCGG - Intronic
1011743061 6:90382505-90382527 CCAGGTGAAGTCAGGGTGTCTGG - Intergenic
1014520460 6:122436148-122436170 CAGTGTGAAGACAGTGTAGGGGG + Intergenic
1015562118 6:134527218-134527240 CAGGGTGAAGGCAAGGGGACGGG - Intergenic
1015707467 6:136103813-136103835 CAGGGTGAGGAAAAGGTGTCAGG - Intronic
1016144399 6:140650198-140650220 TTGGGTGATGACAGGGTGGCTGG - Intergenic
1016147300 6:140692455-140692477 GGGGGAGAAGGCAGGGTGGCAGG + Intergenic
1017950165 6:159129391-159129413 TACGGTGAAGTCAGGGTGGGTGG + Intergenic
1017964842 6:159255247-159255269 CCGGGAGAAGGCAGTGTGGCTGG - Intronic
1018128898 6:160709318-160709340 CTTGGTGAAGGCAGTGTGGCTGG - Intronic
1018345912 6:162899289-162899311 CAGTGTGAAGACAGGAGAGCTGG + Intronic
1019453365 7:1111304-1111326 CAGGGAGGACACAGGGTAGCAGG + Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019687260 7:2388703-2388725 CCTGGTGAGGACATGGTGGCCGG + Intergenic
1019795152 7:3043549-3043571 CAGTGAGATGACACGGTGGCGGG - Intronic
1019979321 7:4609546-4609568 CAGGGTGGGGGCAGGGGGGCTGG + Intergenic
1020029488 7:4922865-4922887 CAGGGTGAGGGCAGGGTGATGGG - Intronic
1020756239 7:12207273-12207295 AAGGCTGGAGGCAGGGTGGCAGG - Intergenic
1021656874 7:22881620-22881642 CTGGGTGCAGGCAGGGGGGCAGG - Intergenic
1021785747 7:24151046-24151068 TAGGGTGAGGACTGGGTTGCTGG + Intergenic
1021906256 7:25336785-25336807 GAGGGAGAAGACAGGGATGCGGG + Intergenic
1022078991 7:27001123-27001145 CTGGACGATGACAGGGTGGCTGG - Intergenic
1023823816 7:43995304-43995326 GAGGGTGAAGATGGGGTGTCTGG - Intergenic
1024142431 7:46475722-46475744 CAAGGTCAAGGCAGGGTGGGGGG + Intergenic
1024250648 7:47503353-47503375 AAGGGGGAGGAAAGGGTGGCAGG - Intronic
1024377398 7:48655477-48655499 GAGAGTGGAGACAGGGTGGAAGG + Intergenic
1024486049 7:49921220-49921242 CAGGGTGAGAACATGCTGGCTGG + Exonic
1024538380 7:50457433-50457455 GAGGGAGGAGACTGGGTGGCAGG - Intronic
1024575941 7:50764186-50764208 CAGGGACAGGACAGGGTGGATGG - Intronic
1025825315 7:65006328-65006350 CAGGGAGGAGACAGGATGCCCGG + Intronic
1026315215 7:69221761-69221783 CACGGTGAAATCAGGGTGGCGGG - Intergenic
1026382630 7:69814641-69814663 CAGGCTGAAAGCAGGGTTGCAGG - Intronic
1027193767 7:76013814-76013836 CAGGATGTAGACGGGGTGGTGGG + Exonic
1027379826 7:77595436-77595458 AAGGGTGAAGACTGGTTAGCAGG + Intronic
1028141836 7:87282776-87282798 TTGGGAGATGACAGGGTGGCTGG - Intergenic
1029752085 7:102548717-102548739 GAGGGTGAAGATGGGGTGTCTGG - Intronic
1029770037 7:102647811-102647833 GAGGGTGAAGATGGGGTGTCTGG - Intronic
1029855827 7:103515832-103515854 CAGAGTGAAAACAAGGTGCCAGG - Intronic
1030252572 7:107463741-107463763 CATGGGGAAGACAAGGTAGCGGG + Intronic
1030321625 7:108174713-108174735 TTGGGTGAAGACAGGATGGGTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030931258 7:115525423-115525445 GAGAGAGAAGGCAGGGTGGCAGG + Intergenic
1031236961 7:119189044-119189066 TTGGGTGATGACAGGGTTGCTGG - Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1032395819 7:131588885-131588907 CTGGGTGCAGGCAGGGTGGCAGG - Intergenic
1033471972 7:141658470-141658492 CGGGGAGAAGACAGGAGGGCTGG + Exonic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034054639 7:148021692-148021714 GAGAATGCAGACAGGGTGGCAGG + Intronic
1034314000 7:150112829-150112851 CAGGGGGAAGACAGCATGCCAGG - Intergenic
1034792899 7:153987963-153987985 CAGGGGGAAGACAGCATGCCAGG + Intronic
1034907885 7:154966717-154966739 CAGGGAGATGACTGTGTGGCTGG - Intronic
1035204178 7:157284060-157284082 CAGGGTGAGGACAGCGTAGGAGG + Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035430332 7:158815370-158815392 CAGGGTGTAGAAATGATGGCTGG - Intronic
1035583786 8:756740-756762 CAGGGTGAGGAGGGTGTGGCTGG - Intergenic
1035619444 8:1026410-1026432 CAGGGTGCAGCCAAGGCGGCGGG - Intergenic
1035674938 8:1449852-1449874 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674949 8:1449899-1449921 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674960 8:1449946-1449968 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674970 8:1449993-1450015 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674980 8:1450040-1450062 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035674990 8:1450092-1450114 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675001 8:1450139-1450161 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675025 8:1450234-1450256 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675036 8:1450281-1450303 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035675066 8:1450422-1450444 GAGGGTGAAGACGAGGTGGGCGG + Intergenic
1035941879 8:3910329-3910351 CAAACTGACGACAGGGTGGCAGG + Intronic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1037569037 8:20142933-20142955 CAGGATGATGAATGGGTGGCAGG - Intergenic
1037747093 8:21654430-21654452 AAGGGTGGAGACAGGGTCCCAGG - Intergenic
1037892390 8:22630143-22630165 CAGGGTGGAGGCCGGGTGGCTGG + Intronic
1037905643 8:22714574-22714596 CAGGGTGGAGAGAGAGTGCCTGG + Intronic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1039913565 8:41843529-41843551 CATGGTGCAGACAGGGCAGCTGG + Intronic
1040998078 8:53421842-53421864 CAGGGGGAAGCCAGTGAGGCAGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1042011644 8:64252487-64252509 GAGGGAGATGACAGGGAGGCTGG + Intergenic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043696573 8:83226870-83226892 CAGGAAGAAGACAGAGTGTCAGG + Intergenic
1044416866 8:91948972-91948994 CAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1044965251 8:97568187-97568209 CAGGGAGAAGAGAGAGAGGCTGG + Intergenic
1045079180 8:98605566-98605588 CAGGGCGAAGACAGAGAGGGAGG - Intronic
1045492197 8:102678646-102678668 CAGGGAGAAGACAGGGGAACAGG + Intergenic
1046314319 8:112479593-112479615 AAGGCTGAAGCCAGAGTGGCTGG - Intronic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048302515 8:133261995-133262017 CAGGGTGGAAACTGGGTGTCGGG - Intronic
1049391701 8:142374992-142375014 CAGGGAGGAGACAGGCTTGCTGG + Intronic
1049468928 8:142766717-142766739 AAGGGTGAGGACAGGGAGGGAGG - Intronic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051096922 9:13477131-13477153 CAGGGTGCATACATGCTGGCTGG + Intergenic
1052410968 9:28120574-28120596 TGGGGTGAAGAAAGGGAGGCGGG - Intronic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1052963400 9:34319661-34319683 CAGGGTGCACACAGGATGGCAGG + Intronic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055304807 9:74918405-74918427 GAGGGTGAAGAGAGGCTGGTTGG + Intergenic
1056076300 9:83044405-83044427 TAGGGTGAAGACAGAGGGGTAGG + Intronic
1056625392 9:88248940-88248962 CAAGGTGAGAACAGGCTGGCTGG + Intergenic
1057045016 9:91878891-91878913 CACGGTGAAACCATGGTGGCAGG + Intronic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057530181 9:95838166-95838188 CAGGGTGGAGACAGTGAGACAGG - Intergenic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1059158530 9:112011907-112011929 CAGGAAGATGACAGGGTGTCCGG - Intergenic
1060587414 9:124795204-124795226 CAGGGTGAAGCCTGGATTGCCGG - Intronic
1060676791 9:125522644-125522666 TAGGGTGAAGAGTGGTTGGCTGG - Intronic
1061227313 9:129288261-129288283 AAGATTGATGACAGGGTGGCTGG - Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061412144 9:130427572-130427594 CAGGGCGAAGCCAGTGGGGCAGG - Exonic
1061577158 9:131514311-131514333 CTGGGGGGAGCCAGGGTGGCGGG - Intronic
1061643710 9:131981723-131981745 CAGTGTGATGACTGGGTGACAGG - Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1061904875 9:133691462-133691484 CAGTGAGAAGGCAGGGTGGCCGG + Intronic
1062111717 9:134785562-134785584 CAGGGTGGAGCCAGGGTGTGTGG - Intronic
1062153595 9:135033936-135033958 CAGGCAGGGGACAGGGTGGCTGG - Intergenic
1062170816 9:135133701-135133723 CAGGGTGCAGGGAGGGTGACTGG + Intergenic
1062327334 9:136018490-136018512 CAGGGTGACTCCAGGGTGGGTGG - Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062457720 9:136647275-136647297 CAGGCTGAGCCCAGGGTGGCAGG + Intergenic
1062465037 9:136677219-136677241 CAGGGAGAAGGCAGGGTGCCAGG - Intronic
1062613919 9:137387583-137387605 CAGTGAGAGGACAGGGTGCCTGG + Intronic
1185633810 X:1536856-1536878 AAGGGAGAAGACAGGGTCGCTGG - Intronic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186212325 X:7262408-7262430 CAGGGTGGAGACATGGGGCCTGG - Intronic
1190111217 X:47590315-47590337 CAGGGTGGGGACAGGTTGGCTGG - Intronic
1190118217 X:47639382-47639404 CAGGCTGGAGGCAGGGTGTCAGG + Intronic
1190172477 X:48122439-48122461 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1190178122 X:48168090-48168112 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1191873468 X:65770046-65770068 CAGGATGAAGAAAGGGTGAAGGG - Intergenic
1192491527 X:71579970-71579992 CAGTGAGAAGCCAGAGTGGCGGG + Intronic
1193990994 X:88307267-88307289 GAGGGTGAAGAGAGGGAGACAGG - Intergenic
1194343342 X:92731341-92731363 GGGAGAGAAGACAGGGTGGCAGG - Intergenic
1194521113 X:94919695-94919717 GAGAGAGAAGGCAGGGTGGCAGG - Intergenic
1195282447 X:103349002-103349024 CAGGGTGAAGGAAGAGTGGAGGG - Intergenic
1195717436 X:107830232-107830254 AAGGGTGAAGACAGGGCTGTGGG + Intronic
1198929717 X:141841146-141841168 CAGGTTGAAGAAAGAGTGACTGG - Intronic
1199144418 X:144348709-144348731 CAGAGAGAAGGCAGGGTGGCAGG + Intergenic
1199783283 X:151082528-151082550 TAGGCTGACCACAGGGTGGCGGG - Intergenic
1200065839 X:153503748-153503770 CAGGCTGCCGCCAGGGTGGCAGG - Intronic
1200651698 Y:5848006-5848028 GGGAGAGAAGACAGGGTGGCAGG - Intergenic
1200746025 Y:6904615-6904637 GGGAGAGAAGACAGGGTGGCAGG + Intergenic
1200777394 Y:7181598-7181620 GAGGGGGAAGACAGGGTGTTAGG + Intergenic