ID: 1003339062

View in Genome Browser
Species Human (GRCh38)
Location 6:5202439-5202461
Sequence CTGTTTGTATGTAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003339062_1003339067 11 Left 1003339062 6:5202439-5202461 CCAACCTCCTTACATACAAACAG 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1003339067 6:5202473-5202495 ACTTTCTATGCCATCCCAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 105
1003339062_1003339069 21 Left 1003339062 6:5202439-5202461 CCAACCTCCTTACATACAAACAG 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1003339069 6:5202483-5202505 CCATCCCAAGAGGCTGCAAAAGG 0: 1
1: 0
2: 2
3: 21
4: 199
1003339062_1003339072 30 Left 1003339062 6:5202439-5202461 CCAACCTCCTTACATACAAACAG 0: 1
1: 0
2: 1
3: 20
4: 216
Right 1003339072 6:5202492-5202514 GAGGCTGCAAAAGGATGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003339062 Original CRISPR CTGTTTGTATGTAAGGAGGT TGG (reversed) Intronic
901081729 1:6587556-6587578 CTGTTTGTGTGTGAGGAGTGTGG + Exonic
906104614 1:43284432-43284454 CAGGTTGGATGTGAGGAGGTTGG - Intronic
907354710 1:53862839-53862861 CTGTTTCTAAGTGAGGAGGCAGG + Intronic
907700655 1:56784690-56784712 ATGTTTGAAAGCAAGGAGGTTGG - Intronic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
914357610 1:146900409-146900431 GTTTTTGTATGTGTGGAGGTGGG + Intergenic
914358431 1:146909048-146909070 CTGCTTGTATCTTGGGAGGTGGG + Intergenic
914494994 1:148187959-148187981 CTGCTTGTATCTTGGGAGGTGGG - Intergenic
914800580 1:150959330-150959352 TTGTTTGTATTTATGCAGGTTGG + Exonic
915418429 1:155760332-155760354 CTGTGTGTCTGGAAGGAGCTGGG + Intronic
918717591 1:187809660-187809682 ATGTATGTATGTAGGTAGGTAGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
919132871 1:193473185-193473207 CTGTTTCTATTTAGGGAGGGTGG + Intergenic
919772158 1:201169132-201169154 CTGTGTGTAGGTATAGAGGTGGG + Intronic
919947736 1:202333327-202333349 CTGTTTGTATATAGGGTGCTTGG - Exonic
920044384 1:203124161-203124183 CTGTGTGTTTGTGAGGCGGTGGG - Intronic
922022608 1:221719548-221719570 CTGCTTGTCTCTGAGGAGGTGGG + Intronic
924401033 1:243682284-243682306 CTTCTTGTATGTAGGGAAGTTGG - Intronic
924581159 1:245325148-245325170 GGGTATGTGTGTAAGGAGGTGGG - Intronic
1065538255 10:26735562-26735584 CTGTTTGCCTGTCAGCAGGTAGG + Exonic
1068690434 10:59908147-59908169 CTGTTTGTATAGCAGGAGGGAGG + Intergenic
1069149261 10:64935122-64935144 CTTTGTTTATGTGAGGAGGTGGG + Intergenic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070700517 10:78598452-78598474 CTGGTTGGGTGTCAGGAGGTAGG - Intergenic
1071369387 10:84935679-84935701 CTGCCTTTTTGTAAGGAGGTGGG - Intergenic
1073957084 10:108884882-108884904 GTGTGTGTGTGTAAGGAGGCAGG + Intergenic
1074195785 10:111183562-111183584 CTGTTTTTATTTAAAGAAGTTGG + Intergenic
1074255914 10:111802402-111802424 GTGTTTGTATGTGGGCAGGTAGG - Intergenic
1074670264 10:115782282-115782304 CTGTTAGTTTCTAAGGAGCTTGG - Intronic
1078943418 11:16034946-16034968 CTGTTTGTATCTATAGAAGTGGG - Intronic
1082911715 11:58384471-58384493 CTGTTTGTAGGTAATGGGGCTGG - Intergenic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1083504947 11:63147789-63147811 CCGTTTGTATGTCAGGAGGTTGG - Intronic
1083517067 11:63270000-63270022 CTGTCTGTATGTCAAGAGTTTGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1086042570 11:82496483-82496505 GTGTTTGTACTTAAGGAGGGTGG + Intergenic
1086097555 11:83065819-83065841 CTGTTTCTTTGTAAGGTTGTTGG - Intronic
1087829683 11:102805885-102805907 CACTTTGTTTGTAAGGGGGTAGG - Intergenic
1088066221 11:105723124-105723146 ATGTTTGTATGTAATTAGGAGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092971517 12:13700097-13700119 CTGTCTGTCTGTGGGGAGGTGGG + Intronic
1093650112 12:21633741-21633763 CTGTCTAGATGTAAGGAGGAGGG - Intergenic
1093884333 12:24441957-24441979 CTTTGTGGATTTAAGGAGGTAGG + Intergenic
1095770074 12:45944569-45944591 CTGTTTGTAAGCGAGGAGGTGGG - Intronic
1095904582 12:47364913-47364935 GGATTTGTAAGTAAGGAGGTAGG + Intergenic
1095969372 12:47891227-47891249 CTGTTTGTAGATAAGGAGACAGG - Intronic
1096056379 12:48655901-48655923 ATGTATGTGTGTAAGTAGGTGGG - Intronic
1096706630 12:53425956-53425978 CTGTGTGTATGTATAGAGGTGGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1109918911 13:69030184-69030206 CTGTATGCATGTAGGTAGGTAGG - Intergenic
1112682847 13:101786989-101787011 CAGATTGTATGTTAGAAGGTGGG - Intronic
1113213963 13:108016750-108016772 CTGGTTGCAAGAAAGGAGGTGGG + Intergenic
1115179113 14:30601673-30601695 GTGTTTGTGTGTAAGAAGGCAGG + Intronic
1115872807 14:37824226-37824248 TTGTTTGTAAGTGAGGAGGAAGG - Intronic
1115960443 14:38830495-38830517 CTGTTTGTATTTAAAGAGTGAGG - Intergenic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120708279 14:87767324-87767346 GTGTTTGCATGTAGGCAGGTGGG - Intergenic
1121804990 14:96810477-96810499 TTGTTTGTGTGTTATGAGGTAGG + Intronic
1124217752 15:27823024-27823046 CTGTGTGTACGGAATGAGGTAGG + Intronic
1126961440 15:54001092-54001114 CTGTTTGTAGCTGAGCAGGTTGG + Intergenic
1129005522 15:72369901-72369923 CTGTTTGGAGGTAAGGAACTGGG + Intronic
1129867154 15:78918003-78918025 CTGTTTGGATTTAAAGAGATCGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131484137 15:92806610-92806632 GTGTATGTATGTAAGTAGGTAGG + Intronic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1131994715 15:98122985-98123007 TTGTTTGTTTGTGGGGAGGTGGG - Intergenic
1134136835 16:11682320-11682342 CTCTTTTAATGTAAGGATGTTGG - Intronic
1135280269 16:21148216-21148238 CTGTTGTTATTTAATGAGGTAGG - Intronic
1138130539 16:54475731-54475753 GTGTTTCTAAGTAAGGAGGCCGG - Intergenic
1138135792 16:54521443-54521465 CTGTTTGTCTGTGAAGAGCTTGG + Intergenic
1138957874 16:61992954-61992976 TTGTGTGTGTGTATGGAGGTGGG + Intronic
1139976572 16:70816886-70816908 GTTTTTGTATGTGTGGAGGTGGG - Intronic
1140279828 16:73544321-73544343 CTCTTTGGATGTAAGGAGGGGGG + Intergenic
1140514231 16:75530599-75530621 CTGTAGGTATGTAAGTAGGTGGG - Exonic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1142778455 17:2161042-2161064 ATGTATGTATGTAGGTAGGTAGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1144806830 17:17973255-17973277 CTCTTTCTATGAAAGGAGGCTGG - Intronic
1146462459 17:33057021-33057043 GTGTGTGTGTTTAAGGAGGTGGG + Intronic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150264516 17:63823752-63823774 CTGTTTGGGTGTTTGGAGGTGGG - Intronic
1150296292 17:64009594-64009616 CTCTCTGTATGCAAGGTGGTGGG - Intronic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1153047946 18:873595-873617 GTGTTTGTGTGGAAAGAGGTAGG + Intergenic
1155460613 18:26078205-26078227 CTGTTTGTACTTAGGCAGGTAGG - Intronic
1155761219 18:29569634-29569656 CTTTTTGTATGTAAGTAGTCAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159472641 18:68878100-68878122 CTGTTTGTTTGTTTGGAGATAGG + Intronic
1159758272 18:72392657-72392679 CTCTTTCTATGTAAGGAGAATGG - Intergenic
1159895545 18:73992275-73992297 CTGTCTGTATGTAAGTAGCTAGG - Intergenic
1162203783 19:9040471-9040493 TTGTATGTTTGTAAGCAGGTGGG - Intergenic
1162252046 19:9453855-9453877 CTGTTTTTTTGTATGAAGGTTGG - Intergenic
1165231760 19:34391677-34391699 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165231882 19:34392575-34392597 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165506741 19:36236819-36236841 CCCTTTGTATGTAAGGAGTGTGG + Exonic
1166021611 19:40036095-40036117 CTGTTTGAATGTAAGGAATGTGG - Exonic
1166025083 19:40075678-40075700 CTGTTTGAATGTAAGGAATGTGG - Exonic
1167123952 19:47536578-47536600 TTGTTTTTATGTAGGGAGGGGGG - Intronic
926745689 2:16155361-16155383 CAGTTTCTAGGTAAGGAAGTTGG + Intergenic
927085623 2:19671921-19671943 CTCTCTGCATATAAGGAGGTAGG - Intergenic
927570156 2:24152610-24152632 CTGTTTGTTTGGGAGAAGGTGGG - Intronic
928661064 2:33502282-33502304 CTGTTTCTGTGTGTGGAGGTGGG + Intronic
931203946 2:60128752-60128774 GTGTTGGTAGGTAAGAAGGTAGG - Intergenic
931434799 2:62236844-62236866 GTGTTTGTCAGTAAAGAGGTGGG + Intergenic
933615883 2:84482107-84482129 CTGTGTTTGTGTCAGGAGGTGGG - Intergenic
934708822 2:96502474-96502496 CCGTTTGTAGGTGAGGAGGCTGG - Intronic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
945448886 2:209970817-209970839 CTGTTTGTATTTCAGGTGATGGG + Exonic
946796453 2:223359451-223359473 CTCTTTGGATTTAAGGAGGTGGG - Intergenic
947998229 2:234546196-234546218 AGGTTTGTATGTGAGGAGGGAGG - Intergenic
1168732424 20:97242-97264 CTGTTTGTATGGCAACAGGTGGG + Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168972503 20:1940237-1940259 CTGTGTGGATTCAAGGAGGTTGG + Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170910444 20:20561403-20561425 CTGTATGTATGAAAGGAGGCAGG - Intronic
1172606148 20:36215460-36215482 CTATGTGTATGTCAGGAGGTTGG - Intronic
1173327569 20:42047804-42047826 CTTTTTGTATTGAAGGAGGCAGG + Intergenic
1174875517 20:54223035-54223057 CAGTTTGTGTGTAAGGAGTAGGG - Intronic
1175467350 20:59198370-59198392 CTGTTGCCATGTAAGGAGGCAGG - Intronic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1183893182 22:40947934-40947956 ATGTTTGTTTGTTAGGAGATAGG + Intergenic
1184303277 22:43576720-43576742 CTATTTGGATGTGAGGAGGAAGG + Intronic
949289464 3:2447212-2447234 CTCCTTGTATGGAGGGAGGTGGG - Intronic
949315002 3:2743428-2743450 GTGTTTGTATATAAGAAGATTGG - Intronic
949380937 3:3445017-3445039 CTTTTTGTATCTCAGGAGGCTGG - Intergenic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
949726473 3:7052550-7052572 CTGTGTGTGTATATGGAGGTGGG - Intronic
950470780 3:13184979-13185001 CTGTTTGTCTGTGTGGAGGTAGG - Intergenic
951880389 3:27475657-27475679 CTGTTTGTATCTGGGGAAGTTGG - Intronic
953152194 3:40334630-40334652 CTGTTTCCATGCAAGAAGGTGGG + Intergenic
954214515 3:49117021-49117043 CTGTTTGGGTGTTAGGAGATGGG - Intronic
954321146 3:49832799-49832821 CTCCTTGTATGACAGGAGGTGGG - Intronic
954974058 3:54676284-54676306 CTGTTTATATGTAAAGAGCATGG - Intronic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
957741428 3:84275054-84275076 GTGTGTGTATGTAAAGGGGTGGG + Intergenic
959321059 3:104876565-104876587 ATGTTTGCATTTAAGAAGGTGGG - Intergenic
962990503 3:140573262-140573284 CTGTTTGTTTGTAATGAGACTGG + Exonic
963316787 3:143767446-143767468 CTGTTTGTTTGTTTGGAGGGAGG + Intronic
963588267 3:147222722-147222744 CTGTGTGTATTTCAGGAGATAGG - Intergenic
967018313 3:185500669-185500691 TTGTTTTTATGTTAGGAGATTGG + Intergenic
967816717 3:193805559-193805581 CTGTCTGTAAATAAGCAGGTTGG + Intergenic
970740051 4:19225815-19225837 TTGTTTGTTTGTAAGGAATTTGG - Intergenic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
971247959 4:24947530-24947552 CTTTTTGTAGGTTAGGAGGGAGG - Intronic
974920668 4:68235322-68235344 TTGTCTGTAGGTAAGTAGGTTGG + Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
976490946 4:85669526-85669548 ATGTTTGTATGTAGGTATGTAGG + Intronic
977883237 4:102230271-102230293 CATTTTGTTTTTAAGGAGGTAGG + Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
981507028 4:145513326-145513348 TTGTTTGTTTGGAAGGAGGTTGG + Intronic
986316016 5:6586804-6586826 CAGTTTGGAAGGAAGGAGGTGGG - Intergenic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
989197799 5:38732554-38732576 CTTTTTGAATACAAGGAGGTGGG - Intergenic
989790887 5:45400227-45400249 CTTTTTGTATGAATGGAGGCAGG + Intronic
990388137 5:55288704-55288726 CTGGTGGTATGGAAGGAGTTAGG + Intronic
990468783 5:56094330-56094352 CTGTTTGTTGGTAAGGAGTAAGG - Intergenic
991905199 5:71502862-71502884 ATGTATGTATGTAAGTATGTGGG - Intronic
993676727 5:90823934-90823956 TTCTTTGTATGTAAGTAGGAAGG - Intronic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
996919955 5:128756416-128756438 CTGAGTATATGTGAGGAGGTAGG + Intronic
997841837 5:137247946-137247968 ATGTTTCGATGTTAGGAGGTGGG - Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
998579550 5:143357546-143357568 CTGTTTGTAGTTCATGAGGTGGG - Intronic
998852514 5:146364437-146364459 CTTTTTGCAGGGAAGGAGGTGGG + Intergenic
998913718 5:146992437-146992459 CTCTTTGTATGGAAGGAGTATGG + Intronic
999690996 5:154145763-154145785 CTGATTATATGTCAGGAGATGGG - Intronic
1000671911 5:164073493-164073515 GTGTGTCTATGTATGGAGGTTGG + Intergenic
1000707622 5:164530921-164530943 CTGTTTGCATGTAAGCAGCAAGG + Intergenic
1001201277 5:169719403-169719425 TTGTTTGTGTGTAATCAGGTTGG + Intronic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1003172036 6:3727458-3727480 CTGTTCTTATGGAAGGAAGTGGG - Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1004103286 6:12637951-12637973 CTGTTTGTAGGAGAGTAGGTTGG - Intergenic
1005179720 6:23091024-23091046 CTGTTTGTTTGCTATGAGGTGGG + Intergenic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005752056 6:28892776-28892798 TTGTTTTTATGTAACTAGGTAGG + Intergenic
1011726314 6:90213750-90213772 CTGTATGTATGTAAGGCAGCGGG - Intronic
1012226699 6:96712233-96712255 CTTTTTTTAAGTAACGAGGTAGG + Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013995147 6:116299606-116299628 ATGTATGTATGTAGGTAGGTAGG + Intronic
1014300033 6:119670281-119670303 GTGTATGTATGTATGGATGTAGG - Intergenic
1014362113 6:120491949-120491971 CTGTTTTTATTTAAAGAGATAGG + Intergenic
1015606975 6:134967997-134968019 CTGTTTCTCTGTTAGGAGGAAGG - Intronic
1015845671 6:137518397-137518419 CTGTCTACATGTAAGGAGCTTGG - Intergenic
1015977470 6:138805550-138805572 CTCTTTGTATGTAGGGGGCTGGG + Intronic
1016573318 6:145539316-145539338 CTGTTTATATGTAATAAGGTAGG + Intronic
1018621715 6:165735276-165735298 CAGTTGGTAGGTAAGTAGGTAGG + Intronic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1020556192 7:9673475-9673497 GTGTGTGTATGCAAGGAGGGTGG + Intergenic
1022415005 7:30170079-30170101 ATATTGGTATGTCAGGAGGTTGG - Intergenic
1022770845 7:33471276-33471298 CTATTTGTTTGTAAAGAAGTTGG + Intronic
1023351389 7:39323448-39323470 CTGTTTCTATGTGTGGAAGTGGG + Intronic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1030071567 7:105702516-105702538 CTGTGTGTGTGTAAGGGGCTGGG - Intronic
1030469533 7:109946322-109946344 CTGTTTGTGTTTGAGGATGTGGG + Intergenic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031513023 7:122672218-122672240 CTGTTGTTATGAAAGGATGTAGG - Intronic
1032497273 7:132371774-132371796 GTGTTTGTGTGTCAGGAGGCAGG - Intronic
1032511619 7:132477236-132477258 GTGTATGTATGCAGGGAGGTGGG - Intronic
1032713328 7:134482115-134482137 TTGTCTGTAGGTACGGAGGTAGG + Intergenic
1035129094 7:156635372-156635394 CTGATTGTATGAAAGGTGTTTGG - Intergenic
1041354008 8:56980795-56980817 ATGTATGTATGTAAGGGTGTGGG - Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1047211478 8:122843685-122843707 CTGTTTGGCTGTAAGGACCTTGG + Intronic
1047359906 8:124159757-124159779 CTGATTTTTGGTAAGGAGGTTGG - Intergenic
1047980988 8:130181939-130181961 CTGTGTATAGGTAAGGATGTTGG - Intronic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1049029936 8:140027279-140027301 CTGTGTATATGTTAGGTGGTTGG - Intronic
1049565386 8:143335310-143335332 CTGTTTGTAGGGGATGAGGTAGG - Intronic
1050933089 9:11355489-11355511 CTTTTTGTATGCAAGGATGAGGG + Intergenic
1056401373 9:86230666-86230688 CTTTTTGAGTGTAAGGAGGTGGG - Intronic
1056715907 9:89027946-89027968 TAGTTTGTCTGTAAGGAGTTGGG - Intronic
1059698069 9:116747733-116747755 CTCTGTGTATGTATGGGGGTAGG - Intronic
1060809779 9:126604974-126604996 CCTTTTGTATGGAATGAGGTTGG - Intergenic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1188279674 X:28249581-28249603 ATGTTTGGATGTTAGGAGGATGG - Intergenic
1188891428 X:35615359-35615381 CTGTTTGAATGTAGGGATTTGGG + Intergenic
1190064073 X:47228683-47228705 CTGTTGGTGGGTAAGCAGGTAGG - Intronic
1191952106 X:66603694-66603716 GTGGTTGTATCTGAGGAGGTAGG + Intronic
1193744617 X:85260813-85260835 CTGTGTGTATGTCAGCAGGGGGG - Intronic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1195593722 X:106663280-106663302 ATATTTATATGTGAGGAGGTAGG - Intronic
1195643726 X:107205994-107206016 GTGTTTGTATGTGTGCAGGTGGG - Intronic
1195679155 X:107530764-107530786 TTGTTTGGGTGGAAGGAGGTAGG - Intronic
1197407999 X:126077725-126077747 CTGGTATTATGTAAGGACGTAGG - Intergenic
1197459070 X:126716476-126716498 CTTTTTACATGTAAGAAGGTCGG - Intergenic