ID: 1003340714

View in Genome Browser
Species Human (GRCh38)
Location 6:5217868-5217890
Sequence AAGGAGAAGCAGACTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003340709_1003340714 9 Left 1003340709 6:5217836-5217858 CCCAACTACTCCAGATTGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG No data
1003340707_1003340714 26 Left 1003340707 6:5217819-5217841 CCTATCTCTAGCTCTACCCCAAC 0: 1
1: 0
2: 4
3: 23
4: 239
Right 1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG No data
1003340711_1003340714 8 Left 1003340711 6:5217837-5217859 CCAACTACTCCAGATTGAAAGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG No data
1003340708_1003340714 10 Left 1003340708 6:5217835-5217857 CCCCAACTACTCCAGATTGAAAG 0: 1
1: 0
2: 0
3: 7
4: 150
Right 1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG No data
1003340712_1003340714 -1 Left 1003340712 6:5217846-5217868 CCAGATTGAAAGGCATAAGACTA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003340714 Original CRISPR AAGGAGAAGCAGACTGAGCC AGG Intronic
No off target data available for this crispr