ID: 1003342453

View in Genome Browser
Species Human (GRCh38)
Location 6:5234915-5234937
Sequence CTCTGGGGGTTTGGGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003342453_1003342464 19 Left 1003342453 6:5234915-5234937 CCCCTACTCCCAAACCCCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 366
Right 1003342464 6:5234957-5234979 GCACTCCAGAGCTTTGTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003342453 Original CRISPR CTCTGGGGGTTTGGGAGTAG GGG (reversed) Intronic
900205817 1:1431487-1431509 CTCTGGGGGAAGGGGTGTAGAGG - Intergenic
902377724 1:16037703-16037725 GTCGGGGGCTTTGGGAGGAGAGG + Intergenic
903135313 1:21305731-21305753 CTCTGTGGGTTTGGGAGGGAGGG + Intronic
903875628 1:26471690-26471712 GTCTGGAGGTTTGGGAATACAGG + Intergenic
904348255 1:29887887-29887909 GTCAGGGGGTTGGGGGGTAGGGG + Intergenic
904462357 1:30687646-30687668 CCTTGGTGGTTTGGGAGCAGAGG - Intergenic
904663727 1:32104064-32104086 CTCTGGGCTTTTTGGAGGAGGGG + Intergenic
905291185 1:36922812-36922834 CTCAGGGGTTTAGGGAGTGGAGG - Intronic
906113328 1:43338821-43338843 CTCAGGGGGTCTGGTAATAGGGG - Intronic
906541063 1:46586414-46586436 CGCAGGGTGTTTGGGAGCAGAGG - Intronic
907771961 1:57474551-57474573 CTCTGGGGGTTAGGAAAAAGTGG + Intronic
907999373 1:59665611-59665633 CTTAGGGGGGTTGGGGGTAGAGG - Intronic
908375281 1:63531146-63531168 CTCTGGGGGTAGGGGAGGATGGG - Intronic
908702818 1:66920503-66920525 CTCTGGGGTTTTGGGCATCGTGG + Intronic
909844011 1:80367390-80367412 CTCTGGAGATTTCGGAGCAGAGG + Intergenic
911370470 1:96989243-96989265 CTCCCAGGGTTTGGGAGGAGAGG - Intergenic
912390559 1:109299839-109299861 CTCTGGTGGCTTGGGAGGGGCGG + Intronic
915142651 1:153776796-153776818 CTCTGGGGGCTTTGAAGGAGTGG - Intronic
915148247 1:153808343-153808365 CACTGGGGTGTGGGGAGTAGAGG + Exonic
915318073 1:155040972-155040994 GACTGGGGGTTTGGGAGAATTGG + Intronic
916636374 1:166673794-166673816 ATGTGGGGGGTTGGGAGTAGGGG + Intergenic
917441690 1:175074150-175074172 CACTGGAGGTTTGGGGGTTGGGG - Intronic
917520293 1:175742766-175742788 GCCTGGGGGGTTGGGAGTGGAGG - Intronic
917659371 1:177163023-177163045 CCCTAAGGGTTGGGGAGTAGGGG + Intronic
917782302 1:178411383-178411405 CTCTGGGGACTTGGGAGGAAGGG + Intronic
918904097 1:190468722-190468744 CTTTTGGGGGGTGGGAGTAGAGG + Intronic
920394213 1:205631962-205631984 GTCGGGGGGTTTGAGAGTGGCGG - Exonic
920764786 1:208821787-208821809 CCCTGGGGGGTTGGGGGTGGGGG - Intergenic
921198742 1:212783289-212783311 TTTTGGGGGTTTAGGGGTAGTGG + Intronic
921947695 1:220897609-220897631 CTCTGGGGGTGGGGGGCTAGGGG - Intergenic
1062882189 10:988089-988111 GTCTTGGGATTTGGGAGTTGCGG - Exonic
1064983283 10:21185366-21185388 TCCTGGGGGTCAGGGAGTAGAGG + Intergenic
1068241588 10:54308778-54308800 GTCTGGGGGTCGGGGAATAGGGG - Intronic
1069540648 10:69291470-69291492 CACTGGGCCTTTGGGAGTGGTGG - Intronic
1069614986 10:69801395-69801417 GGTTGGGGGCTTGGGAGTAGAGG + Intergenic
1069638162 10:69938041-69938063 CTTGGAGGGTTTGGAAGTAGTGG + Intronic
1070050410 10:72883212-72883234 AACTGGGGGTTTGGGGGGAGAGG + Intronic
1070261094 10:74856609-74856631 GTGTGGGGGTCTGGGAGTGGTGG + Intronic
1070448435 10:76532171-76532193 GTCGGGGGGTATGGGAGTAGGGG - Intronic
1071428415 10:85582732-85582754 TTCTGGGGCTTTGGGGATAGTGG - Intergenic
1071729337 10:88232345-88232367 CTATGTGGGTGTGGGTGTAGTGG - Intergenic
1071852318 10:89586395-89586417 CTGTGGGGGGTAGGGAGTGGAGG + Intronic
1071939448 10:90573073-90573095 CTATGGGAGTTTGGCAGTGGTGG + Intergenic
1072235272 10:93448199-93448221 ATTGGGGGGTTAGGGAGTAGGGG - Intronic
1072614217 10:97038709-97038731 CTCTGGGGCTTTGGGAAGTGGGG - Intronic
1072857868 10:98968828-98968850 CTCTGGGGAGTTGGGAGGAAGGG + Intronic
1073629130 10:105130579-105130601 CTCTGGGTGTGTGTGTGTAGGGG - Intronic
1074619963 10:115108351-115108373 CACAAGGGGTTTAGGAGTAGAGG + Intronic
1074856986 10:117480904-117480926 ATCTGGGTGTTTGAGACTAGGGG + Intergenic
1075205387 10:120443484-120443506 CTGTGGGGGTTGGGGAGCAAGGG + Intergenic
1075401612 10:122164838-122164860 TTCTGGGGACTTGGGGGTAGGGG + Intronic
1075454557 10:122576737-122576759 CTCTGGAGGGTTGGGTGTGGTGG + Intronic
1076892964 10:133293802-133293824 CTGTGGGGGCATGGGAGTGGGGG - Intronic
1077046065 11:545739-545761 TTCTGGGGGTTTGGGCAAAGTGG + Intronic
1077383193 11:2257048-2257070 CCCTGGGGCTCTGGGAGTGGAGG + Intergenic
1077519694 11:3025125-3025147 CTCCGGGTTTGTGGGAGTAGAGG - Intronic
1077976507 11:7252726-7252748 CTCTGGGAAGTTGGGAGTTGGGG + Intronic
1078239043 11:9513561-9513583 CACTGGGGGTTTCTCAGTAGTGG - Intronic
1079858982 11:25643635-25643657 TTCTGGTGGTGTGAGAGTAGAGG + Intergenic
1080742965 11:35082793-35082815 CTTTTGGGGTGTGGGAGGAGGGG - Intergenic
1081581171 11:44353119-44353141 ACCTGGGGGTTTGGGAGGATTGG + Intergenic
1081911182 11:46700896-46700918 GACTGGGAGTTTGGGAGTACTGG - Exonic
1082171133 11:49007208-49007230 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1083163071 11:60867521-60867543 CTCTGGTGGCGAGGGAGTAGGGG + Intergenic
1083364048 11:62130595-62130617 GTCTGGGGGCTTGGCAGTGGCGG + Intronic
1084904874 11:72337958-72337980 CACTGGGGGGTTGGGACTTGTGG - Intronic
1084934597 11:72580100-72580122 CTCTGGGGGTGTGCAAGCAGGGG + Intronic
1085025085 11:73231683-73231705 CTCAGGGTCTATGGGAGTAGAGG + Intronic
1086041173 11:82481222-82481244 CTGTTGGGGGTTGGGAGTTGAGG - Intergenic
1086181454 11:83956404-83956426 CTCTGGGGCTATGGGATTATGGG + Intronic
1086315702 11:85589545-85589567 CTGTGGGGGTGTGGGAGGGGTGG + Intronic
1086339740 11:85836547-85836569 CCCTGGGGCTTTGGGAGAAATGG - Intergenic
1086694769 11:89829881-89829903 ATCTGGGGGTTGGGGGATAGGGG + Intergenic
1086711379 11:90014616-90014638 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1087014462 11:93542736-93542758 GCCTGGGGGTCGGGGAGTAGAGG - Intronic
1088240176 11:107765888-107765910 CTCTGGGGACTTGGGAGGAAGGG + Intergenic
1088392564 11:109330950-109330972 GTTTGGGGGTTTGGGGATAGAGG + Intergenic
1088421022 11:109646924-109646946 CTCAGGTGGTTTGGTATTAGAGG + Intergenic
1089031012 11:115329599-115329621 CACTGGGGCTTTGGGAGTCACGG - Intronic
1089136878 11:116256331-116256353 TCCTGGGGGGTTGGGAGCAGTGG - Intergenic
1089178703 11:116566258-116566280 CTTTGGGGGTGTGGGGGTGGAGG + Intergenic
1089186507 11:116619232-116619254 CTGTGGGGGTGGGGGACTAGGGG - Intergenic
1089574260 11:119430473-119430495 CTCTGGGAGGTTGGGTGCAGTGG + Intergenic
1091021998 11:132108516-132108538 CTCTGGGGACTTGGGAGGAAGGG + Intronic
1091601632 12:1921427-1921449 CCCTGGGGGCTTCGGAGCAGAGG - Intergenic
1091799782 12:3317456-3317478 CTGTGGGGGTCTGGGGGCAGTGG + Intergenic
1092262489 12:6960004-6960026 ACCTGGGGGTTTGGGGGTGGGGG + Intronic
1092618562 12:10237639-10237661 CTCTGGGGCTTTGGGATCATGGG + Intergenic
1094051568 12:26226530-26226552 CTCTGGGGGTTCGGGGATTGGGG + Intronic
1094633044 12:32196617-32196639 GTCTGGGGGTGAGGGATTAGGGG + Intronic
1097267302 12:57753612-57753634 CTTTGGGGGTATGGGAGTAAAGG + Intronic
1098155954 12:67598567-67598589 CTGTGGGGTTTTGTGAATAGAGG - Intergenic
1098858577 12:75682205-75682227 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1099251388 12:80259527-80259549 GTCTGGGGGTGTGGGGCTAGGGG - Intronic
1099502055 12:83426170-83426192 CTCAGGGGGTTGGGGATTAGGGG - Intergenic
1100757903 12:97772790-97772812 CTCTGGGGCTTTGGGGGCTGTGG - Intergenic
1102656481 12:114486200-114486222 CTCTGGGGGCTTGGTGGTGGGGG - Intergenic
1104321776 12:127758298-127758320 CTCTGGGGGTTGGGGGGTAAGGG + Intergenic
1104636775 12:130442481-130442503 CTATGTGGGTTGGGGAGTGGAGG + Exonic
1107118343 13:36771332-36771354 GTCGGGGGGTTGGGGACTAGGGG - Intergenic
1107540186 13:41382163-41382185 CCCTGGTGGATTAGGAGTAGGGG - Intergenic
1107883873 13:44857887-44857909 CTGGGAGGGTTTGGTAGTAGGGG - Intergenic
1108060625 13:46529524-46529546 GTGTGGGGGTTGGGGAGGAGGGG - Intergenic
1108380612 13:49850638-49850660 CTCTGGGGGTTTGGTGGGAAGGG - Intergenic
1108607330 13:52052725-52052747 TTCTGGTGGCTTGGGTGTAGAGG - Intronic
1108700701 13:52941561-52941583 CCCTGGGGGTTGGGGTGTTGAGG + Intergenic
1109359206 13:61274138-61274160 ATCTGTGGTTTTGGGAGCAGTGG - Intergenic
1109406233 13:61903519-61903541 CTCTGGGGCTTTGGGGGCATGGG + Intergenic
1109676126 13:65677100-65677122 CACTGGTGGCATGGGAGTAGAGG + Intergenic
1110509665 13:76334790-76334812 AACTGGGGGTTTGGGGGCAGGGG - Intergenic
1110770047 13:79331657-79331679 CTCTGTGAGTTTGGGACTATAGG + Intronic
1111962464 13:94826190-94826212 CTCTGGGGGTTTGGGGGGTGGGG - Intergenic
1112422077 13:99261357-99261379 CTCTTTGGGTGTGGGTGTAGGGG + Intronic
1113249849 13:108440312-108440334 CTCTGGGGTCTTTGGAGTAAGGG - Intergenic
1113654952 13:112062257-112062279 CTCTGGGAGCTTTGGAGTAGGGG - Intergenic
1114564038 14:23614882-23614904 CCCTGGGAGTTTGGGAGTGATGG + Intergenic
1114716993 14:24837519-24837541 CTCTGTGGTTTTGGGAGTGATGG + Intronic
1115835134 14:37393854-37393876 CTTTGGGGACTTGGGAGGAGGGG - Intronic
1117257713 14:53996590-53996612 CTCTTGGCGTTTGGAAGTTGAGG - Intergenic
1121145646 14:91579750-91579772 CTCTGGGGCTTTGGGGATCGTGG + Intergenic
1121879507 14:97487505-97487527 CGCAGGGGATTTGGGAGTTGAGG - Intergenic
1123885477 15:24722918-24722940 GTCAGGGGGTTGGGGGGTAGGGG + Intergenic
1124230255 15:27938846-27938868 CTCTGTGGCCTTGGGAGTGGCGG + Intronic
1124601467 15:31136141-31136163 CTCTGGGAGAGTGGGAGGAGGGG + Intronic
1124882478 15:33655245-33655267 CTCAGGGGATTTGGGGGTGGAGG - Intronic
1125070084 15:35544347-35544369 CTGTGGGGGTTTGGGGGTTAGGG + Intronic
1125709684 15:41774710-41774732 CTCTGGAGGATAGGGAGTGGGGG + Intronic
1126710748 15:51453072-51453094 CTCTGGGGGCTTGGGAGGGGTGG + Intronic
1128541024 15:68533143-68533165 CTCTGGGGATTTGTGTCTAGAGG - Intergenic
1129153308 15:73702666-73702688 CACTGGGGTTCTGGGAGCAGTGG - Intronic
1129153617 15:73704070-73704092 CACTGGGGTTCTGGGAGCAGTGG - Intronic
1129868387 15:78925753-78925775 CTCTGGGTTTATGGGTGTAGGGG - Intronic
1130912489 15:88280695-88280717 CACTGGGGGTATGGGAGTACTGG - Intergenic
1131380443 15:91959258-91959280 CTCTGGGGACTTGGGGGTTGGGG + Intronic
1131461600 15:92621754-92621776 TTCTGTGGGTTGGGGAGTCGGGG + Intronic
1131890456 15:96966336-96966358 GTCAGGGGTTTTGGGGGTAGGGG + Intergenic
1134072941 16:11272041-11272063 ATTTGTGGGTCTGGGAGTAGTGG + Intronic
1136070727 16:27785386-27785408 CTGTGGGGCTTTGGGGGTTGTGG - Intergenic
1136417555 16:30113088-30113110 CTCTGGGGCTTGGGGTCTAGGGG + Intronic
1137334482 16:47533991-47534013 CTCTTGGGGCCTGGGAGGAGGGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141954435 16:87360975-87360997 CTGTGGTGGGGTGGGAGTAGGGG - Intronic
1142035903 16:87862034-87862056 CTGTGGGGGGTTGGGGGTGGAGG + Intronic
1142688853 17:1592841-1592863 GGCTGGGGGTTGGGGAGCAGGGG + Intronic
1143201807 17:5118469-5118491 CTCTGGGGATTTGGGATCACAGG - Intronic
1144078593 17:11741694-11741716 CCCTGGGTGTTTAGGATTAGAGG + Intronic
1144429275 17:15175525-15175547 CTGTGGGGACTTGGGGGTAGGGG - Intergenic
1144678583 17:17177455-17177477 TTATGGGGGTTTGGTCGTAGAGG + Intronic
1144997668 17:19281717-19281739 CTCTGAGGGTTTGAGGGTGGGGG + Intronic
1146471761 17:33130588-33130610 CTTGGGGGGTTGGGGAGTTGAGG - Intronic
1146475974 17:33163076-33163098 TTCTGGTGGGGTGGGAGTAGGGG + Intronic
1147216310 17:38901143-38901165 CCCTGTGGGTTTTGGAGGAGGGG + Intronic
1148026550 17:44593010-44593032 TTCTGGGGGCTTGAGAGTGGAGG + Intergenic
1148048852 17:44759490-44759512 CTCTGCGGGTTTGGGCGGATGGG + Intronic
1148071241 17:44910054-44910076 CTCAGGGGGATTGGGAGGATGGG + Intronic
1148130825 17:45261872-45261894 TGCCGGGGGTTTGGGAGCAGGGG + Intronic
1148496638 17:48056889-48056911 TTCTGGGAGTTTGGGACTCGGGG + Intronic
1150231167 17:63551296-63551318 CCCGGGGGGGGTGGGAGTAGGGG - Intronic
1150387456 17:64773313-64773335 CTTTGGGGACTTGGGAGTGGGGG + Intergenic
1150601011 17:66651026-66651048 CAGTGGGAGTTTGGGAGAAGGGG + Intronic
1151263120 17:72932438-72932460 CTGTGGGGGGTGGGGGGTAGGGG - Intronic
1151367386 17:73626358-73626380 CCCTTGGGGTTTGGGTGTGGTGG - Intronic
1152091550 17:78250355-78250377 CTCTGGGGACTTGGGGGTGGGGG + Intergenic
1152178653 17:78803885-78803907 CCCTGGGGGCTTGGGGGTACTGG + Exonic
1152558185 17:81065049-81065071 CTCAGGGGCTTTGAGAGCAGTGG - Intronic
1153583435 18:6598144-6598166 CTCTGGGGGCTTGGGGCTGGAGG + Intergenic
1153701805 18:7701847-7701869 GTCAGGGGGTTGGGGAGTAGGGG - Intronic
1155904721 18:31436051-31436073 GTGTGGGGGGTTGGGAGTATAGG + Intergenic
1157168604 18:45381722-45381744 CTCCGGGGGTTGGGGGGCAGGGG + Intronic
1157370380 18:47105714-47105736 CTCTGGAGGTGTGGGTGGAGGGG + Intergenic
1159100427 18:63951890-63951912 TTCTGGGGAGTTGGGAGTAGTGG + Intronic
1159138829 18:64368652-64368674 ATTTGGGTGTTTGGGAGTAGTGG - Intergenic
1160941106 19:1620909-1620931 CTGTGAGGGTTTGGGGGGAGGGG - Intronic
1161286636 19:3471854-3471876 CTTTTGGGGTTTTGGAGTTGGGG - Intergenic
1161530315 19:4785174-4785196 CACTGGGGGGTTGGGAGGGGAGG - Intergenic
1162125156 19:8495583-8495605 CTGTGGGGATTTGGGAGTGGAGG + Intronic
1163520780 19:17790407-17790429 CTCTGGGTGTCAGAGAGTAGTGG + Intergenic
1163628296 19:18403533-18403555 GTCTTGGGGTTTGGGAGTCCTGG + Intergenic
1163628330 19:18403629-18403651 GTCTTGGGGTTTGGGAGTCCTGG + Intergenic
1165073295 19:33267860-33267882 CTCTGGGGGTGAGGGAGCGGGGG - Intergenic
1165981189 19:39725685-39725707 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1166382162 19:42360851-42360873 CTCTGGGGGTTTCGGGGGAGTGG + Exonic
1166774317 19:45303100-45303122 ATCTGGGGGACTGGGAGTGGGGG + Exonic
1167092685 19:47355362-47355384 GTCTGGGGATGTGGGAGGAGGGG - Intronic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
925238554 2:2300681-2300703 CTCTGGTGGTGTGGGAGGAGAGG + Intronic
926117224 2:10221182-10221204 CTCTGGGGGTGGGGGGGTGGCGG + Intergenic
928402811 2:30991529-30991551 CTCTGGGTCTTTGGCAGTAGGGG + Intronic
929127385 2:38534290-38534312 CTCTGGGGTCTTGAGAGGAGTGG - Intergenic
930346531 2:50189361-50189383 TGCTGGGGGTTGGGGGGTAGGGG + Intronic
930993224 2:57685449-57685471 CTCAGGTGGTATGGGAGTAGTGG - Intergenic
931363333 2:61597270-61597292 TTGTGGGGGTTGGGGAGTGGCGG - Intergenic
931718364 2:65047392-65047414 TTCTGGGCAGTTGGGAGTAGAGG + Intergenic
932335894 2:70931197-70931219 CACTGGGTGTTGGGTAGTAGAGG + Intronic
934180241 2:89612714-89612736 CTCTGGGGGTGGGGGGGTGGGGG - Intergenic
935101816 2:100003091-100003113 CTCTGGGGAGTTGGGGGTCGGGG + Intronic
935806486 2:106753809-106753831 GTCTGGGGGCTTGGGAGCATGGG - Intergenic
936682753 2:114793292-114793314 GTCTGGGGGTGGGGGACTAGAGG - Intronic
937515313 2:122648175-122648197 CACTGGAGATTTGGAAGTAGGGG - Intergenic
938122586 2:128644385-128644407 CTCTGGGGGGATGGGGGAAGAGG - Intergenic
939509597 2:143089689-143089711 CTCGGGGGGTGTGGGGGGAGTGG + Intergenic
939528633 2:143328580-143328602 GTCAGGGGGTAGGGGAGTAGGGG + Intronic
940418893 2:153455638-153455660 CTCTGGGGCTTCAGGAGTCGTGG - Intergenic
941681700 2:168406892-168406914 GTCGGGGGGTTGGGGGGTAGAGG - Intergenic
944344561 2:198646375-198646397 CTCTGGGGGGGTGGAATTAGGGG + Intergenic
945263628 2:207868421-207868443 CTCTGGGTATTGGGAAGTAGTGG + Intronic
945868572 2:215203026-215203048 CTCTGGGGCTTTGGGGGTTGTGG - Intergenic
946067057 2:216996909-216996931 CTCTAGGACTTTGGGAGGAGAGG - Intergenic
946908164 2:224435974-224435996 CCCTGGGGGTGTGGGGGTGGGGG - Intergenic
947330014 2:229018781-229018803 GGCTGGGGATTTGGGAGTTGAGG - Intronic
947816300 2:233039886-233039908 ATCTGGGTGTTGGGGTGTAGGGG + Intergenic
948883836 2:240873380-240873402 CTCTGGGGGGTTGGGCAGAGGGG - Intronic
948896270 2:240929255-240929277 CTCTGGGGGTTCTGGAGAACGGG + Intronic
948916228 2:241036094-241036116 GGGTGGGGGTTGGGGAGTAGAGG + Intronic
948936255 2:241166877-241166899 CTCTGTGGGCTGGGAAGTAGGGG - Intronic
1169381620 20:5112628-5112650 CTGAGGGAGTTTGGGGGTAGCGG - Intronic
1169432317 20:5548859-5548881 CACAGGGGGATTAGGAGTAGGGG - Intronic
1169440168 20:5627196-5627218 CTCTGGGGCCTTGGGGGTCGTGG + Intergenic
1172671966 20:36640882-36640904 CTCTGGGGGCTGGGGAGGTGGGG + Intronic
1173577004 20:44118679-44118701 CTTTGTGGGTTGGGGAGAAGGGG - Intronic
1173758454 20:45538933-45538955 CTCTGTGGGTATGGGTGTGGGGG + Intronic
1174310959 20:49654014-49654036 CTCTGGGCATTTGGCAGTACTGG - Intronic
1175468298 20:59207981-59208003 CTCTGGGGGTTGGGGAGCAGAGG - Intronic
1176512484 21:7759219-7759241 CTCTGGGGTCTTGCGAGAAGTGG - Intronic
1176891247 21:14322039-14322061 CTCTGGAGTTTTGGGGGTTGGGG - Intergenic
1177531899 21:22371456-22371478 CTGTTGGGGGTTGGGAGTAAGGG - Intergenic
1177782909 21:25639569-25639591 TTTTGGGGGTGTGGGGGTAGGGG - Exonic
1178078940 21:29042380-29042402 CCCTGTGGGATGGGGAGTAGGGG - Intronic
1178584934 21:33863898-33863920 CTCTGGGGTGTGGGGAGCAGTGG - Intronic
1179659076 21:42863174-42863196 CTCTGCAGATTTGGGAGCAGGGG - Intronic
1179980672 21:44894182-44894204 CTCTGGGGGTTTGGGGCTCACGG + Intronic
1181695916 22:24592788-24592810 GTCTGGGGGTCTGGGAGGCGCGG - Intronic
1181942303 22:26487793-26487815 CTCTTGGGTTTTGGGAGTCCAGG + Intronic
1182281523 22:29220257-29220279 CACTGGGGATGTGGGAGTAATGG - Intronic
1182449540 22:30410779-30410801 CTCTGCTAGTTTGGGAGCAGTGG + Intronic
1182585891 22:31344242-31344264 ATCTGGGGGTGTGGGATTTGTGG - Intronic
1183395381 22:37568384-37568406 CGCTGGGGGGTTTGCAGTAGTGG - Exonic
1184216411 22:43070400-43070422 CTCTGGGGGTTGGTGAGGACAGG - Intronic
950282757 3:11720873-11720895 CTCTGGGGATTTGGTGGTGGGGG + Intergenic
950641796 3:14353362-14353384 TTCTGGGGGTGTGGGAGCAGTGG - Intergenic
951350658 3:21602923-21602945 ATCTGGAGGTTTAGGATTAGTGG - Intronic
951694274 3:25429163-25429185 ATGTGGGGGGTGGGGAGTAGAGG + Intronic
953572027 3:44078783-44078805 CTATGGGGGTTTGGAAGTTCAGG + Intergenic
954401874 3:50323298-50323320 CTGTGTGGGTTGGGGAGGAGGGG + Intronic
955241710 3:57183809-57183831 GACTGGGGGTTTGGGAGGAAGGG + Intergenic
956169103 3:66418912-66418934 CTTTGGGGGCTGGGGAGGAGAGG - Intronic
956397531 3:68841691-68841713 GTCAGGGGGTTGGGGGGTAGGGG - Intronic
957632569 3:82736847-82736869 CTCTGGGGGGATGGGAGGTGAGG - Intergenic
959046160 3:101476246-101476268 CTTTGGGGGATTGGGGGTAAGGG - Intronic
959359760 3:105373879-105373901 CTCAAGGAGTTTGGGAGTTGAGG + Intronic
959743345 3:109747286-109747308 TTCTGTGGGTGTGGGAGTAGTGG + Intergenic
961151744 3:124644471-124644493 GTCTGGGGGTTGGGGGCTAGGGG - Intronic
961321805 3:126082261-126082283 CCCTGGGGCTCTGGGATTAGAGG - Intronic
962349557 3:134646759-134646781 TACTGGGGCTCTGGGAGTAGAGG + Intronic
963251155 3:143104631-143104653 CTCTCGGGGTTTGGGAATGTTGG + Intergenic
963702014 3:148638316-148638338 CTTTGGGGACTTGGGAATAGTGG + Intergenic
965334397 3:167418420-167418442 CTGTTGGGGTTGGGGAGCAGGGG - Intergenic
965634395 3:170766826-170766848 CTATGGGGGATTGGGAGTAAGGG - Intronic
966318108 3:178671415-178671437 CTCTAGAGGTTGGGCAGTAGTGG - Intronic
968705540 4:2075767-2075789 CTCTGGGGAGCTGGGAGAAGGGG + Intronic
970070594 4:12155308-12155330 GTCAGGGGGTTGGGGACTAGGGG - Intergenic
971207306 4:24583726-24583748 CTCGGGGGAGGTGGGAGTAGAGG - Intronic
971296552 4:25398620-25398642 CCTTGGGGATTTGGGAGTAGTGG + Intronic
972177015 4:36420268-36420290 CTCTGGGGCTTTGGGATTGCAGG + Intergenic
973729333 4:53808631-53808653 TTCTAGAGGTTTGGAAGTAGAGG - Intronic
976341546 4:83951244-83951266 CTCTGGTGGCTTGGGATTTGGGG + Intergenic
976883559 4:89960204-89960226 CTCTGGGGCTTTGGGGGTTGTGG - Intergenic
977622486 4:99153320-99153342 CTTTGGGGATTTGGGAGGAAGGG - Intronic
980603576 4:135059255-135059277 CTCTGGGGCTCCGGGAGTTGCGG + Intergenic
980638435 4:135539825-135539847 CTTTAGGGGTGGGGGAGTAGGGG - Intergenic
981692883 4:147528891-147528913 CACTGGGGGGTTTGGAGCAGAGG + Intronic
982174019 4:152688470-152688492 CTGTGGGGCTTTGGCAGGAGAGG + Intronic
984298650 4:177886874-177886896 TTCTGGGGCTTTGAGATTAGAGG - Intronic
985758604 5:1733466-1733488 CCCTGGGGGTCAGGGAGGAGAGG - Intergenic
985848696 5:2372880-2372902 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
986650620 5:9959943-9959965 GTCAGGGGGTGTGGGACTAGGGG - Intergenic
988350949 5:30106623-30106645 CTCTGGGGCTTCGGGGGTCGTGG + Intergenic
988798409 5:34673864-34673886 CTCTGGGGTTTTTAGAGTTGGGG - Intronic
988807823 5:34756652-34756674 CACTGAAGGTTTGGGAGCAGAGG - Intronic
989400937 5:41006819-41006841 CTTTGGGGGTTTGGGGGAAAGGG + Intronic
990379306 5:55206630-55206652 CACAGGGAGTTTAGGAGTAGAGG - Intergenic
990553534 5:56908589-56908611 ATCTGGGTGTTGGGGAGGAGCGG + Intergenic
990982094 5:61611004-61611026 GACTTGGGGTTGGGGAGTAGGGG - Intergenic
991218619 5:64185768-64185790 CTCTGGGAGTTTACAAGTAGAGG + Intronic
992058066 5:73012825-73012847 CTGTGGGGTTTTGGGGGTAGGGG - Intronic
992179897 5:74185523-74185545 CTCTGAGGTTTGGGCAGTAGTGG - Intergenic
992672666 5:79075634-79075656 CTGTGGGGAGTTGGGAGGAGTGG + Intronic
992951242 5:81859963-81859985 CTCTGGGGAATTGGGATGAGGGG - Intergenic
993060218 5:83029830-83029852 ACCTGGGGTTTTGGGAGTGGTGG - Intergenic
994627003 5:102232541-102232563 CCCTGGGGCTTCGGGAGTCGTGG - Intergenic
996970512 5:129361230-129361252 GTGTTGGGGGTTGGGAGTAGTGG - Intergenic
997214795 5:132101659-132101681 CTCTAGGAGTTTGGGAGAAGGGG + Intergenic
997226825 5:132215184-132215206 ATCTGGTGGGGTGGGAGTAGGGG + Intronic
997355911 5:133262919-133262941 CTCTGTTGGTTTGGGTGTCGGGG + Intronic
997432276 5:133848682-133848704 CTCTGGGGGTCTGGCTGTTGAGG - Intergenic
997453483 5:134001874-134001896 CTCAGGGGGTTTGGGATGAGTGG - Intronic
997600353 5:135134564-135134586 CTCTGGGGGTGTGTTAGCAGGGG + Intronic
998216412 5:140241290-140241312 CTCTGGAGGCTGGGGAGAAGGGG + Intronic
998373564 5:141676717-141676739 ATCTAGAGGTTTGGGAGAAGCGG - Intronic
1000235309 5:159353733-159353755 CTCTGAGGGTAGGGGAGTTGAGG + Intergenic
1001588481 5:172849588-172849610 CTTTGGGGGGTTGAGAGTTGGGG + Intronic
1002043917 5:176531774-176531796 CCCCGGGGGCCTGGGAGTAGAGG - Intronic
1002688757 5:181036298-181036320 GTCAGGCTGTTTGGGAGTAGAGG + Intergenic
1003342453 6:5234915-5234937 CTCTGGGGGTTTGGGAGTAGGGG - Intronic
1003644670 6:7904878-7904900 CTCTGGAGGGATGGGAGCAGGGG - Intronic
1004046379 6:12027892-12027914 TTCTGGTGGTTTTGGGGTAGTGG + Intronic
1005822231 6:29607424-29607446 CCCTGGTGGTGTGGAAGTAGAGG - Intronic
1006648885 6:35534852-35534874 AGCTGGGGGTTTGGGGGAAGAGG - Intergenic
1006860506 6:37169426-37169448 TTCTGGGGGTTTGTGTGTTGGGG - Intergenic
1007178828 6:39913878-39913900 CTGTGGGGGTGTGGGGGAAGAGG - Intronic
1007368523 6:41411385-41411407 TTTTGGGGGGTGGGGAGTAGGGG - Intergenic
1007483079 6:42162810-42162832 CTCTGGGGGCTTCTGAGCAGTGG + Intronic
1007618437 6:43196476-43196498 CTTTATGGGTTTGGGAGGAGTGG + Intronic
1008847664 6:55987368-55987390 GACTGGGGGTTTGGGGGAAGTGG - Intergenic
1011233852 6:85193315-85193337 CTCTGGGGCTTCAGGAGTCGTGG + Intergenic
1011251951 6:85381013-85381035 CTGTCGGGGGTTGGGAGTAAGGG + Intergenic
1011775344 6:90724195-90724217 CTCTGGGGATTTAGTAGCAGAGG + Intergenic
1012198905 6:96380487-96380509 CTCTGTGTGTTTGGGAGAAATGG - Intergenic
1015689356 6:135904273-135904295 CTCTGGGGTCTTGGGAGCATTGG - Intronic
1016502581 6:144738368-144738390 CTCTGGAGGTTTGGGGGTAGGGG - Intronic
1017405862 6:154117466-154117488 CTTGTGGGATTTGGGAGTAGGGG - Intronic
1020071028 7:5227167-5227189 CTCTGGGGGTCTGGAAGGAAAGG - Exonic
1020338437 7:7083584-7083606 GTCTGGGGGTAGGGGGGTAGGGG - Intergenic
1023126369 7:36958434-36958456 CTCTGGAGGTTTGTGAATAGAGG - Intronic
1023243212 7:38171785-38171807 TTATCAGGGTTTGGGAGTAGGGG - Intergenic
1023257992 7:38330830-38330852 CTCTGGGGTCTTGGAAGTAAGGG + Intergenic
1023367055 7:39474965-39474987 CTCTGGGGGGTAGGGATTTGGGG - Intronic
1023844317 7:44112432-44112454 CTCTGGGGGTTGGGGGACAGGGG + Intronic
1024479950 7:49852775-49852797 ATCTGGGAGTTTGAGAGCAGAGG - Intronic
1024933491 7:54689117-54689139 CTGTTGGGGTTTGGGGGTAGGGG + Intergenic
1026281056 7:68922051-68922073 CTCTGGGGCTTTGGGAGTCGTGG + Intergenic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1028469129 7:91185900-91185922 CTGTGGGGGTTTGGGGGAAGTGG - Intronic
1028934411 7:96449115-96449137 TTCTGGGTGTTTTTGAGTAGAGG + Intergenic
1029506082 7:100964946-100964968 CTCTGGCAGGTTGGGAGAAGGGG + Intronic
1029896780 7:103990971-103990993 CTCTGGGGATTTTGAAGTAAGGG - Intergenic
1030323540 7:108195139-108195161 CCCTGGGATTTTGTGAGTAGTGG - Intronic
1030389964 7:108915509-108915531 CTTTGGGGATTTGGGAGGAAGGG - Intergenic
1030648657 7:112092903-112092925 CAGTGGGCGTTTGGGAGAAGTGG + Intronic
1033658344 7:143387963-143387985 CTCAGGGGGTTTGGGCAGAGTGG + Intronic
1034499024 7:151438336-151438358 TTTTGGGGGCCTGGGAGTAGGGG - Intronic
1034877654 7:154739449-154739471 CTGTGGGGGAATGGGAGTATGGG + Intronic
1035031395 7:155863300-155863322 CCCTGGGGCTTTGTGAGGAGAGG + Intergenic
1035356691 7:158280002-158280024 CTCTGTGGGTTCGGGGGCAGCGG - Intronic
1035412182 7:158653926-158653948 CGTTAGGGGTTAGGGAGTAGGGG + Intronic
1035913868 8:3597832-3597854 GTCGGGGGGTTGGGGACTAGGGG + Intronic
1038380718 8:27090676-27090698 TTCTGGGGGCTTGGAAGAAGAGG - Intergenic
1038696034 8:29807260-29807282 CTCTGGGGGTTTCTGTGAAGGGG - Intergenic
1039405573 8:37309669-37309691 CCCTGAGGGTTTTGGAGCAGGGG - Intergenic
1043478440 8:80627969-80627991 CTCTGGGAGCCTGGGAGCAGAGG + Intergenic
1043629755 8:82315167-82315189 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
1045146270 8:99347752-99347774 CTATTGAGGTGTGGGAGTAGTGG + Intronic
1048467601 8:134679932-134679954 CTGTGGGGGGTTGGGGGTTGGGG + Intronic
1049029404 8:140023265-140023287 CTCTGGTGATGTTGGAGTAGTGG - Intronic
1051125597 9:13800950-13800972 CTCTGGGGGTGAGGGCGGAGTGG + Intergenic
1051460021 9:17301544-17301566 CTTGGGGAGTGTGGGAGTAGGGG + Intronic
1053469108 9:38332965-38332987 CTCTGAGGGACTGGGAGGAGAGG + Intergenic
1053545320 9:39017566-39017588 CTCTGGGGGTTCAGGGGTCGTGG - Intergenic
1056037820 9:82627520-82627542 CTCTGCATGTTTGGGGGTAGAGG + Intergenic
1058548424 9:106086435-106086457 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
1058771247 9:108234515-108234537 CTCTGGGGACTTGGGAGGAAAGG + Intergenic
1059520089 9:114932852-114932874 CACTGAAGGTTTGTGAGTAGAGG - Intergenic
1060345060 9:122808671-122808693 CTTTGGGGGTTTGGGAATTTGGG + Intronic
1060896513 9:127221775-127221797 CTCTTGGGGCTTGGGAGGTGGGG - Exonic
1061147310 9:128807659-128807681 GTCTGGGGGTTGGGGAGTGTGGG + Intronic
1062071339 9:134556582-134556604 CCCTGAGGGTTTGGCAGGAGTGG - Intergenic
1062151050 9:135019263-135019285 CTCAGGGGCTTTGGCAGGAGGGG - Intergenic
1187688744 X:21842261-21842283 CTCTGGGGTTGTGGGGATAGGGG - Intronic
1188048029 X:25450564-25450586 GTCAGGGGGTTTGGGGTTAGGGG + Intergenic
1188694344 X:33171320-33171342 CTCTGGGGGTTTAAGAGAAAAGG + Intronic
1188887213 X:35565341-35565363 CTCAGGGAGATTGGGAATAGTGG + Intergenic
1188925399 X:36036211-36036233 TTCTAGGGGCTTGGGAGTGGGGG - Intronic
1190168560 X:48093195-48093217 CTCTGGAGGAATGGGAGTGGAGG - Intergenic
1190310195 X:49111843-49111865 TTCTGGGGGCTTGGCAGAAGAGG + Intergenic
1190379620 X:49827522-49827544 GTGTGGGGGGTTGGGGGTAGGGG - Intergenic
1192005939 X:67212440-67212462 CTCAAGGGGTTTTTGAGTAGTGG - Intergenic
1192576312 X:72245885-72245907 CTTTCGGGGTTTGGGTGAAGTGG + Intronic
1193057435 X:77168499-77168521 CTGTGGGTGTTTGGGGGTAGGGG + Intergenic
1193421440 X:81287648-81287670 GTCTGTGGGTGGGGGAGTAGGGG + Intronic
1193476707 X:81974768-81974790 GTCAGGGGGTGTGGGAGTAGGGG + Intergenic
1193607233 X:83583658-83583680 CTCTGCTTGTTGGGGAGTAGGGG - Intergenic
1193798254 X:85903518-85903540 GTATGGGGGTTTGGGAGTTAGGG + Intronic
1194039846 X:88927407-88927429 GTTGGGGGGTTGGGGAGTAGGGG - Intergenic
1194505222 X:94725999-94726021 CTCTGGGGACTTGGGAGAAAGGG + Intergenic
1194669509 X:96713404-96713426 CTGTGGGTGTGTGGGAATAGAGG - Intronic
1195211144 X:102652891-102652913 CTCTGGAGGTTGGTGAGAAGGGG + Exonic
1195217297 X:102713842-102713864 CTCTGGAGGTTAGTGAGAAGGGG + Exonic
1195504754 X:105644373-105644395 TTATGGGGGTTTGGGAGAAAAGG - Intronic
1195534620 X:105997238-105997260 GTCTGGGGGTGGGGGACTAGGGG + Intergenic
1195877711 X:109559516-109559538 CTTTGGGGGTTTTTGAGCAGAGG - Intergenic
1196499052 X:116357001-116357023 TTCAGGTGGTTTGGGAGAAGTGG - Intergenic
1196516903 X:116624547-116624569 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1196584634 X:117416093-117416115 CTTTGGGGGTTTGTGGCTAGGGG - Intergenic
1196752351 X:119129331-119129353 CACTGGGGGGTTTGGAGCAGGGG + Intronic
1196768656 X:119272244-119272266 CTCTGGTTTTTTGGGAGGAGGGG - Intergenic
1197639006 X:128947524-128947546 GTCTGGGGGTGGGGGACTAGGGG - Intergenic
1199607316 X:149586872-149586894 CACTGGGGGTCAGAGAGTAGCGG - Intronic
1199628445 X:149760598-149760620 ATCTCAGGGGTTGGGAGTAGAGG + Intergenic
1199631807 X:149782495-149782517 CACTGGGGGTCAGAGAGTAGCGG + Intronic
1199925788 X:152462304-152462326 CTCAGGGGGTGGGGGACTAGGGG - Intergenic
1200144588 X:153920183-153920205 CTCTGGGACTCTGGGAGCAGAGG - Intronic