ID: 1003343971

View in Genome Browser
Species Human (GRCh38)
Location 6:5248257-5248279
Sequence CAGCACAGGGAGAAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 748}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003343971_1003343982 29 Left 1003343971 6:5248257-5248279 CCAGTCCCCTTCTCCCTGTGCTG 0: 1
1: 0
2: 6
3: 87
4: 748
Right 1003343982 6:5248309-5248331 CATCTGAGTAAACTCAACTAGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1003343971_1003343981 28 Left 1003343971 6:5248257-5248279 CCAGTCCCCTTCTCCCTGTGCTG 0: 1
1: 0
2: 6
3: 87
4: 748
Right 1003343981 6:5248308-5248330 ACATCTGAGTAAACTCAACTAGG No data
1003343971_1003343977 -4 Left 1003343971 6:5248257-5248279 CCAGTCCCCTTCTCCCTGTGCTG 0: 1
1: 0
2: 6
3: 87
4: 748
Right 1003343977 6:5248276-5248298 GCTGTCACATTGCTGTAGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 142
1003343971_1003343978 3 Left 1003343971 6:5248257-5248279 CCAGTCCCCTTCTCCCTGTGCTG 0: 1
1: 0
2: 6
3: 87
4: 748
Right 1003343978 6:5248283-5248305 CATTGCTGTAGCCAGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003343971 Original CRISPR CAGCACAGGGAGAAGGGGAC TGG (reversed) Intronic
900387639 1:2417777-2417799 CAGCCCTGGGAGGAGGGGACGGG + Intergenic
900396082 1:2453802-2453824 CCCCACCGGGAGACGGGGACAGG - Intronic
900413270 1:2523341-2523363 CAGCACTGGGGGCAGGGGAGGGG - Intronic
900560855 1:3305382-3305404 CAGCACAGCGAGGCGGGGCCTGG - Intronic
901065625 1:6492905-6492927 GGGCACAGGGAGAAGGGGACGGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901820846 1:11828440-11828462 GAGCACTGAGAGAAGGGGAAAGG - Exonic
902216146 1:14935689-14935711 GGGTACAGGGAGAAGGGGAAGGG - Intronic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
902515952 1:16989775-16989797 GAGCACAGGGAGATGGGGGAGGG + Intronic
902978920 1:20109371-20109393 CAGCCCAGGGACAAAGTGACAGG - Intergenic
903046719 1:20569871-20569893 AGCCACAGGTAGAAGGGGACTGG + Intergenic
903395318 1:22997607-22997629 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
903790105 1:25886971-25886993 CAGAACAGGGTGGTGGGGACCGG - Intronic
904172779 1:28603166-28603188 AAGTACAGGGAAAAGGGGAAGGG + Exonic
904333778 1:29784283-29784305 CAGCAGGGGGAGAAGGTGAGAGG + Intergenic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
905255376 1:36678379-36678401 AGGCAAAGGGAGAAGTGGACTGG + Intergenic
905636705 1:39558797-39558819 GAGCACAGGGAGGAGAGGAAGGG + Intergenic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
906049671 1:42859760-42859782 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906081386 1:43091038-43091060 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
906982603 1:50647929-50647951 CAGCACGGGAAGAAGGGCATAGG + Intronic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
907299340 1:53476796-53476818 CAGCAGAGGGTCAAGGGGCCTGG + Intergenic
907414273 1:54303374-54303396 CAGCCCAGGGGGCAGGGGGCAGG + Intronic
907722685 1:56986812-56986834 CAGCACACAGAGAAGGGGTTTGG - Intergenic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
910413150 1:86967444-86967466 CAGTAGGGGGAGAAGGGGAGGGG - Intronic
910444921 1:87290496-87290518 AGGGACAGGGAGAAGGGGATGGG + Intergenic
911265123 1:95734105-95734127 CAGCACAGGGAGAAAAGTAGAGG + Intergenic
911569616 1:99507593-99507615 CAACAGAGGGAGAGGGGGAGGGG - Intergenic
913039820 1:115011430-115011452 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
913245035 1:116863758-116863780 CAGCCAGGGGAGAAGGGGAGAGG - Intergenic
913260115 1:116990066-116990088 CAACAGAGGAAGAAGGGAACTGG + Exonic
914063829 1:144229018-144229040 CAGGGCAGGGAGCAGGGTACAGG - Intergenic
914115321 1:144737336-144737358 CAGGGCAGGGAGCAGGGTACAGG + Intergenic
914446770 1:147757308-147757330 CAGCCAAGGGAGAAAGGGAAGGG + Exonic
914998660 1:152566592-152566614 CAGCAATGGGGGAAGGGGGCAGG - Intronic
915092100 1:153433692-153433714 CTGCACAGGGAGAGGATGACCGG + Intergenic
915351771 1:155231477-155231499 GAGCACAGGCTGAAGGAGACTGG + Intergenic
916676567 1:167068848-167068870 CAGCACAGGGAGAAGAGCCCAGG - Intronic
916786457 1:168090513-168090535 CAACACAGGGAAAACGCGACAGG + Intronic
916853268 1:168725508-168725530 CAGCACAGGCTGTAGGGCACTGG - Intronic
916942301 1:169688600-169688622 CAGCAAAGGGAGATGGGGTGGGG - Intronic
917092947 1:171372262-171372284 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
917199703 1:172501510-172501532 AAGCACAGGGACTAGGGGCCAGG - Intergenic
917294912 1:173508552-173508574 TAGCAGAGGGATAAGGGGATTGG - Intronic
917750860 1:178052148-178052170 CAGCAGAGTGAGAAGGTGAGAGG - Intergenic
918143420 1:181736493-181736515 CAGGGCAGGGTGAAGGGGAGAGG + Intronic
918511159 1:185316331-185316353 AAGCGCGGGGAGAAGGGGGCGGG - Intronic
920085021 1:203409025-203409047 CTACACAGGGAGAAGGCGACCGG + Intergenic
920206552 1:204296489-204296511 CAGCAAAGCGAGTAGGGGAGTGG - Intronic
920296470 1:204960372-204960394 CAGCATAGGCAGAGTGGGACGGG - Intronic
920427432 1:205889320-205889342 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
920698706 1:208201494-208201516 CAGGGCTGGGAGTAGGGGACAGG + Intronic
920907911 1:210188931-210188953 CAGCCTAGGGAGGAGGGGAGAGG - Intergenic
920964419 1:210690342-210690364 CAGCTCTGGGAGAAGAGGCCTGG - Intronic
921079438 1:211726738-211726760 CAGCACTGGGAATAGGGGACAGG + Intergenic
921955354 1:220977678-220977700 CAGCACAGGGGACAGGGCACAGG - Intergenic
922609387 1:226913181-226913203 CAGTAAAGTGAGAAGGGGAGAGG + Intronic
922796297 1:228341394-228341416 CAGCACAGGGAGGGGGACACGGG - Intronic
923074888 1:230601523-230601545 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
923138722 1:231141975-231141997 GGTCGCAGGGAGAAGGGGACTGG + Intergenic
923394227 1:233544666-233544688 CGGCACAGGGAGAAGGAACCAGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923963266 1:239106941-239106963 CAGCAAAGGGAGATAGGGGCGGG - Intergenic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1064414133 10:15134317-15134339 GAGCACTGGGAGCAGGGGGCAGG - Intronic
1065133451 10:22644998-22645020 CAGCATAGGGGGAAGGGGGTAGG - Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1065214791 10:23439237-23439259 CAGCGCAGGGGGGCGGGGACGGG - Intergenic
1065341990 10:24716310-24716332 TGGCACAGGGAGCAGGGGAGGGG + Intronic
1065731542 10:28713823-28713845 CAGCACAGGGAAAAGGGTGAAGG - Intergenic
1065916044 10:30355778-30355800 CAGCCCAGGGATCAGGGGGCAGG - Intronic
1066015155 10:31233603-31233625 CTACACAGGGAAAAGAGGACTGG + Intergenic
1066103492 10:32137741-32137763 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1066402679 10:35090590-35090612 CAGCAGCGGAAGAAGGAGACCGG - Intronic
1066497545 10:35956788-35956810 CAGAAGAGGGAGAAAGGGAGGGG - Intergenic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067360060 10:45571448-45571470 CAGCAAAGGGAGAAAGGGTGGGG - Intronic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1067409833 10:46054655-46054677 CAGCAAAGGGAGATGGGGAAGGG + Intergenic
1067508680 10:46877419-46877441 CAACACAGGGTGAGGGGGAATGG - Intergenic
1067653570 10:48174431-48174453 CAACACAGGGTGAGGGGGAATGG + Intronic
1067698665 10:48553231-48553253 CAGTTCAGGGAGAGCGGGACGGG - Intronic
1068360524 10:55971776-55971798 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1068764815 10:60751513-60751535 AAGAACAGGGATAAGGTGACTGG - Intergenic
1068954783 10:62813097-62813119 CAACAAAGGGAGAGAGGGACAGG + Exonic
1069562715 10:69442027-69442049 CAGCAGGGAGAGCAGGGGACAGG + Intergenic
1069862063 10:71477825-71477847 CAGCAGAGAGAGAAAGGGACAGG - Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070747648 10:78944350-78944372 CAGCACAGGAGGAAGGGAAAGGG + Intergenic
1070828692 10:79405736-79405758 CAGCCCTGGGAGGAGGGGACAGG + Intronic
1071265030 10:83957575-83957597 CAGCACTGGGAGTTGGGGATGGG - Intergenic
1071305356 10:84294687-84294709 CAGCCCAAACAGAAGGGGACAGG + Intergenic
1071307043 10:84308806-84308828 CAGTACAGGGAGCAGAGGGCAGG - Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1072010805 10:91301449-91301471 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072011630 10:91307021-91307043 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1072897195 10:99377059-99377081 CACTGCAGCGAGAAGGGGACCGG - Exonic
1073801913 10:107050708-107050730 CAGCACAGAGGAAATGGGACTGG + Intronic
1074014294 10:109518035-109518057 CAGCAGAGGGAAACGGGGAGAGG + Intergenic
1074060474 10:109960880-109960902 CTGCCCAGGGAGAAGGGGAGGGG + Intergenic
1074749559 10:116571564-116571586 CAGAACAGGGAGTTGGGTACAGG - Intergenic
1074765167 10:116695001-116695023 CAGTAAGGGGACAAGGGGACAGG - Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075456694 10:122589512-122589534 AAGCAGAGGGAGAAGAGGAAAGG + Intronic
1075479110 10:122764302-122764324 GGGCACAAGGGGAAGGGGACTGG - Intergenic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076442155 10:130487401-130487423 CAGCGAAGGGAGATGGGGAGGGG - Intergenic
1076803172 10:132841975-132841997 CAGCACAGAGAGGAAGGGCCGGG - Intronic
1076946643 10:133656280-133656302 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1076995026 11:293635-293657 GGACTCAGGGAGAAGGGGACTGG - Exonic
1077102129 11:827105-827127 CAGCGCAGAGAGGCGGGGACAGG + Intronic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077542965 11:3156141-3156163 CAGCCCAGCGAGATGGGGCCTGG - Intronic
1077797484 11:5507762-5507784 CAGCATATGGAGAAAGGGAGGGG + Exonic
1077923262 11:6656437-6656459 AGACACAGGGAGAAGGGGATGGG - Intergenic
1078552482 11:12290135-12290157 CAGCCCAGGGACAAGGGGCTCGG + Intronic
1079018533 11:16889321-16889343 CAGCGAAGGGAGATGGGGAAGGG - Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1081287738 11:41292269-41292291 GAGCAGAGGGAAAAGAGGACTGG - Intronic
1081572539 11:44300696-44300718 CAACACAGGGAGAAATGGAGTGG + Intronic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082632609 11:55559677-55559699 CAGCAAAGGGAGAAAGGCATGGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1083202835 11:61130872-61130894 CAACAGAGTGAGAAGGGGAGGGG + Exonic
1083353055 11:62044819-62044841 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1083534256 11:63454078-63454100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084175005 11:67418473-67418495 CAGCACAGGCAGAAAGGTGCTGG - Exonic
1084353705 11:68623078-68623100 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084355229 11:68634049-68634071 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1084576481 11:69991920-69991942 CAGCACAGAGGGAGGGGGCCTGG - Intergenic
1084585261 11:70057527-70057549 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1084740141 11:71134137-71134159 CAGCACAGGTGGGAGGGGAGGGG + Intronic
1084961146 11:72717334-72717356 CAGTCCAGGGAGGTGGGGACAGG + Intronic
1084962792 11:72726124-72726146 TGGCAGTGGGAGAAGGGGACAGG + Intronic
1084978661 11:72816875-72816897 CAGCACAGGCAGCAGGGGCAGGG - Intronic
1085326876 11:75613089-75613111 CAGCACAGGGTGTGGGAGACAGG - Intronic
1085627831 11:78086909-78086931 CAGCGAAGGGAGATGGGGAAGGG - Intergenic
1085772850 11:79340304-79340326 CAGCCCAGGGAGGTGGGGTCAGG + Intronic
1085879404 11:80448214-80448236 AAGGATAGGGAGAAGGGGAATGG - Intergenic
1085901075 11:80700292-80700314 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1086125572 11:83345287-83345309 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1086549926 11:88043679-88043701 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1087195269 11:95298670-95298692 CTGCACTGGGAGAAGGGCAGAGG + Intergenic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1087946285 11:104164207-104164229 CAGCACAGGCTGCAGGGGGCGGG + Intronic
1088096632 11:106108198-106108220 AAACACAGGGAGAGGGGGAGAGG - Intergenic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089284063 11:117394479-117394501 CGGCACAGGGAGCAGGTGAGGGG + Exonic
1089567958 11:119382002-119382024 CAGCCCAGTGAGAAGGGGAGTGG - Intergenic
1089808995 11:121116012-121116034 CAGCACAGGGAAAGGGGCAGAGG - Intronic
1089953166 11:122548219-122548241 CAGCCTAGGGAGGAGGGGAAAGG - Intergenic
1090657411 11:128856480-128856502 CAGAAGAGGGAGCAGGGGAGGGG + Intronic
1090983831 11:131748550-131748572 GGGCACAGGGAGGAGGGGGCAGG - Intronic
1091025240 11:132135798-132135820 CTGCACAGGGAGAGAGAGACAGG + Intronic
1091549975 12:1530073-1530095 CGGCGCCGGGAGAAGGGGGCCGG + Intronic
1091629934 12:2152420-2152442 CTGCAGAGGGAGAAAGGGAAAGG - Intronic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092416468 12:8293843-8293865 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1095511113 12:42952752-42952774 CAGCACAGGGACCTGGGGCCTGG - Intergenic
1095955454 12:47803202-47803224 CAGTTCAGGGTCAAGGGGACAGG + Intronic
1096526210 12:52211837-52211859 CTGCAGAGGGAGGAGGGGATGGG + Intergenic
1096839167 12:54370257-54370279 CAGTACGGGGAGAAGAGGATGGG + Exonic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096879420 12:54655332-54655354 CAGAACAGGAAGAAGGGAAGTGG - Intergenic
1097124888 12:56766190-56766212 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1098402074 12:70086533-70086555 CAGCACAGAGATAAGAGGTCAGG - Intergenic
1098654163 12:73007418-73007440 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1099872651 12:88368962-88368984 CAGCTTGGGGAGAAGGGGAGAGG - Intergenic
1100355108 12:93821446-93821468 CAACAGAGGGACTAGGGGACTGG - Intronic
1101396786 12:104355819-104355841 CAGAACAGGGAGAGAGGGGCAGG + Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102435488 12:112919513-112919535 CCCCACAGGCAGAAGAGGACTGG + Exonic
1102586717 12:113928666-113928688 CAGCTCAGGGAGTTGGGAACAGG + Intronic
1102815103 12:115859077-115859099 CAGCACAGGGAGTGTGGGTCGGG + Intergenic
1102959684 12:117084646-117084668 CAGAACAGGGAGGATGGGAGGGG + Intronic
1103913710 12:124365376-124365398 CAGCACTGGCAGCTGGGGACTGG - Intronic
1103930715 12:124449442-124449464 CGGCTCAGGGAGATGGGGAGTGG - Intronic
1104410153 12:128551068-128551090 CTGGAAAGGGAGAAGGGGAGAGG - Intronic
1105819007 13:24063118-24063140 GAGCACTGGGAGAAGGAGCCTGG - Intronic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107610891 13:42111869-42111891 CTGGACAGGGAAAAGGGCACAGG + Intronic
1107961544 13:45563646-45563668 CAGTACATGCAGAAGGGGAGAGG + Intronic
1108966756 13:56316707-56316729 CTGCCCAGTGAGAAGGGTACAGG - Intergenic
1109422526 13:62132042-62132064 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1109791581 13:67255375-67255397 TAGCACATGGAGACGGGGAGGGG + Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1111083086 13:83337759-83337781 CAGCACAGGGATACTGGGCCTGG - Intergenic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1112996918 13:105585693-105585715 CAGCCCCGGGAGATGGAGACAGG + Intergenic
1113535526 13:111063298-111063320 CAGCAAAGGGAGATGGGGAGGGG - Intergenic
1113579063 13:111415513-111415535 GAGCACAGGGAGAATGAGATTGG - Intergenic
1113750895 13:112775913-112775935 TGGCAAGGGGAGAAGGGGACGGG - Intronic
1113753513 13:112792706-112792728 CAGCACAGGAAGCAGGGAACGGG - Intronic
1114197852 14:20494873-20494895 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1114221414 14:20701130-20701152 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114222180 14:20706455-20706477 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114346068 14:21796544-21796566 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1114573913 14:23695346-23695368 CAGCACCGGGAGAAGAGCAAAGG + Intergenic
1115133432 14:30080568-30080590 CAGCTCAGCTACAAGGGGACTGG - Intronic
1115404124 14:32996514-32996536 CAGCACAGGGACCCGGGGCCCGG - Intronic
1115968247 14:38916010-38916032 CAGCACAGGGACCATGGGGCTGG + Intergenic
1116933022 14:50708988-50709010 CAGCAAGGGGAGTAGGGGAAAGG - Intergenic
1118574223 14:67225458-67225480 CAGCACAGGGAGGAGGAGAGAGG + Intronic
1119248496 14:73132722-73132744 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1119480111 14:74953675-74953697 CAGCACACGGAGAGTGGGGCTGG - Intronic
1120341360 14:83225194-83225216 CAGCGAAGGGAGATGGGGAAGGG + Intergenic
1120618711 14:86736939-86736961 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1120646599 14:87081894-87081916 CTGCACAGGGAGAAAGAGCCTGG + Intergenic
1121289098 14:92760081-92760103 CAGCAAAGGGAGATGGGGAAGGG - Intergenic
1121495684 14:94390177-94390199 GAGCTCAGAGAGAAGGGGAGGGG - Intronic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122032116 14:98919778-98919800 CAGCAGAGGCACAAGAGGACTGG + Intergenic
1202901968 14_GL000194v1_random:49456-49478 AAGCACATGGAGAGGGGGACTGG - Intergenic
1202920732 14_KI270723v1_random:28834-28856 CAGCACAGGCAGCGGGGGACAGG + Intergenic
1202924186 14_KI270724v1_random:8747-8769 CAGCACAGGCAGCGGGGGACAGG - Intergenic
1123882760 15:24690727-24690749 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1124444364 15:29716090-29716112 AAGCACAGGGAAAAGATGACTGG + Intronic
1125079605 15:35657078-35657100 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1125592142 15:40861331-40861353 CAGCACAGGGAGAGGGACAGAGG + Intergenic
1125848994 15:42886175-42886197 CAGCCTGGGGAGAAGGGGAGAGG - Intronic
1127117877 15:55744886-55744908 GGGAACAGGGAGAAGGGGAAGGG - Intergenic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1128638396 15:69317779-69317801 CAGCATGGGGAGAAGGGGAAAGG - Intronic
1129114129 15:73355626-73355648 CAGCACAGTGAGAACAGGCCTGG + Intronic
1130459969 15:84153611-84153633 CAGCCGAGGGAGAAAGGGAGAGG + Intergenic
1130697339 15:86143932-86143954 TAGCACAGGGAGAAAGCGTCAGG + Intronic
1131058754 15:89391636-89391658 CAGCTCAGGGAGACAGGGAAAGG - Intergenic
1131141242 15:89978258-89978280 CAGCTCATTGAGAAGGGGCCAGG + Intergenic
1131770731 15:95734737-95734759 CTGCACAGGAAGAGGGAGACAGG + Intergenic
1132124693 15:99212612-99212634 CAGCCCAGGGAGAAAGGCACTGG + Intronic
1132606352 16:795391-795413 CAGCACAGGGGGGCGGGCACGGG - Intronic
1132606427 16:795575-795597 CAGCACAGGGGGGCGGGCACGGG - Intronic
1132643503 16:988487-988509 CAGCACCTGGGGAGGGGGACTGG - Intergenic
1132703496 16:1231550-1231572 GAGCACAGGGAGCTGGGGCCGGG - Intergenic
1132705016 16:1239811-1239833 GAGCACAGGGAGCTGGGGCCGGG + Intergenic
1132708018 16:1254845-1254867 GAGCACAGGGAGCTGGGGCCGGG + Intergenic
1133059260 16:3163956-3163978 CAGCGAAGGGAGATGGGGAAGGG - Intergenic
1133725033 16:8529460-8529482 TATCACATGGAGAAGTGGACAGG + Intergenic
1134044865 16:11093669-11093691 CAGCACAGGTGGAAGAGGGCAGG + Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134846855 16:17447638-17447660 CATCCCAGGGAGAAGGAGAGAGG + Intronic
1135025507 16:18996201-18996223 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
1135491139 16:22910787-22910809 CAGGAAAGGTAGAAGGGGAAGGG + Intronic
1135518179 16:23152533-23152555 CAGCACAGGCAGACAGAGACGGG + Intergenic
1136146162 16:28317779-28317801 CAGCCCAGGGGGAAAGAGACTGG + Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136455721 16:30378704-30378726 CGGGACAGTGGGAAGGGGACAGG + Intronic
1137571892 16:49571796-49571818 CAAAACAGGGACAAGGGAACAGG + Intronic
1138417780 16:56881107-56881129 CTGCATAGGGAGCAGGGGCCAGG - Intronic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138528952 16:57624729-57624751 CAGGACAGGGATAAGGGGTTAGG - Intronic
1138554179 16:57762506-57762528 CAGCACTGGGATGAGGGGCCTGG + Intronic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138658020 16:58501755-58501777 CACCTCAGGGGGATGGGGACAGG + Intronic
1139062474 16:63270115-63270137 CTTCACAGGCAGAATGGGACAGG - Intergenic
1139231142 16:65283578-65283600 CAGCACCTGGTGAAGGGGCCTGG + Intergenic
1139662051 16:68427909-68427931 GAGCACAGGGAACAAGGGACTGG - Intronic
1139953364 16:70682269-70682291 CAGCTCAGGGTGAAGGGGCCTGG + Intronic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140076919 16:71708451-71708473 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1140943955 16:79749833-79749855 CAGCCCAGGAGGAAGGGGACTGG - Intergenic
1141424294 16:83935386-83935408 GAGCCCAGGGAGATGGAGACGGG + Intronic
1141483073 16:84319610-84319632 GCTTACAGGGAGAAGGGGACTGG - Intronic
1141669906 16:85486195-85486217 GAGTACAGAGAGAAGGGGAGAGG - Intergenic
1141675630 16:85515835-85515857 CAGAAGAGGCAGGAGGGGACCGG - Intergenic
1141749208 16:85946965-85946987 CAGCACAGGGAGGAGGGAGGAGG - Intergenic
1141872500 16:86797482-86797504 CAGCACACAAAGAAGGGAACAGG - Intergenic
1142157495 16:88539291-88539313 CAGCTCAGGTAGAAGGGAGCAGG - Intergenic
1142523240 17:519586-519608 CTGCACAGGGAGGATGGGGCAGG - Intronic
1142624572 17:1183586-1183608 CAGGACAGAAAAAAGGGGACGGG + Intronic
1143117495 17:4589088-4589110 CGGCAAAGGGAGGAGGGGAAGGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143414488 17:6736021-6736043 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1143416865 17:6756724-6756746 GAGCAGGGGGAGAAGGGGCCAGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1143771294 17:9170636-9170658 CAGCACAGAGAGGTGGGGGCGGG + Intronic
1144181107 17:12753285-12753307 GGGCCCAGGGAGAAGGGCACAGG + Exonic
1144703575 17:17353489-17353511 CAGGACAGGCAGAAAGGGTCAGG + Intergenic
1144714450 17:17424355-17424377 CAGCTGAGGCAGCAGGGGACTGG - Intergenic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1145871219 17:28275049-28275071 CATGACAGGGAACAGGGGACAGG + Intergenic
1145883538 17:28368200-28368222 AAGCACAGGGGGAAGGGAATTGG - Intronic
1146397480 17:32480310-32480332 CATCACAGGGAAGAGGGGCCAGG - Intronic
1146456899 17:33015652-33015674 CAGCAGGGGGAGAACTGGACAGG - Intronic
1147000531 17:37359120-37359142 CGGCACACGGAGAAGGGGCGGGG + Intronic
1147559526 17:41500370-41500392 GAGCACAGAGAGAAGGGGCCAGG + Intergenic
1147658727 17:42105641-42105663 CAGCACAGAGAGGTGGGGGCAGG - Intronic
1147869571 17:43578001-43578023 CAAGACAGGAAGAAGGGGAGGGG + Intronic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1148440908 17:47711207-47711229 CAGAACAGGGAAAGGAGGACAGG - Exonic
1149320496 17:55476396-55476418 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149575928 17:57713354-57713376 CAGCAAGGAGAAAAGGGGACGGG + Intergenic
1150673173 17:67220172-67220194 CAGCACAGCGAGGAGAGGGCAGG - Intronic
1150712838 17:67546445-67546467 GAGCACAGGGAAGAGGGGCCCGG - Intronic
1150787916 17:68177696-68177718 GAGGACAGGAAGAAGGGGATGGG - Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1151892510 17:76958998-76959020 CAGCACAGGGAGATTGGGAGAGG - Intergenic
1152042120 17:77910135-77910157 GAGGACAGGGAGAGGGGGCCTGG - Intergenic
1152207327 17:78981123-78981145 CATCTCTGGGAGTAGGGGACAGG + Intergenic
1152239322 17:79153256-79153278 CAGCACAGGGTGCAGGGAAATGG - Intronic
1152411618 17:80127069-80127091 CAACACTGGGAGACCGGGACAGG + Intergenic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1153759097 18:8312940-8312962 CAGCACAGGCAGAAGGAAATCGG - Intronic
1154310875 18:13265413-13265435 CAGCACAGTGGGAAGGGGGAGGG - Intronic
1155081856 18:22418356-22418378 CACCAAAGGGATAAGGGGGCAGG - Intergenic
1155961851 18:32001904-32001926 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1156252200 18:35361485-35361507 CAGCAAAGGGAGATAGGGGCGGG + Intergenic
1156506154 18:37595635-37595657 CAACCCAGGGAGAAGAGAACAGG - Intergenic
1156506542 18:37599412-37599434 CACCACAGGGAGAAGTCCACTGG + Intergenic
1156939191 18:42744179-42744201 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157301679 18:46484022-46484044 GAGCAGAGGGAGGAGGGGAAGGG + Intronic
1157368102 18:47085044-47085066 CAGCATAGGGAGCTGGGGCCGGG - Intronic
1157724210 18:49951205-49951227 CAGCAAAGGGAGAGGTGGATGGG - Intronic
1158664564 18:59420837-59420859 CAGCTGTGGGAGAAGAGGACCGG - Intergenic
1158695229 18:59697470-59697492 CTGCACGGGGAGCAGGGGTCCGG + Intergenic
1158710049 18:59829560-59829582 CAGCACAGGGATAAGGGATGAGG + Intergenic
1159164964 18:64687200-64687222 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1159741764 18:72180180-72180202 GCTCACAGAGAGAAGGGGACTGG - Intergenic
1160225707 18:77009273-77009295 CCACACAAGGAGAAGAGGACAGG + Intronic
1160581277 18:79885783-79885805 CAGGACAGGGAGATGGGGATGGG + Intronic
1160581297 18:79885840-79885862 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581317 18:79885897-79885919 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581336 18:79885953-79885975 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581352 18:79886010-79886032 CAAGACAGGGAGATGGGGATGGG + Intronic
1160581372 18:79886067-79886089 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581392 18:79886124-79886146 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581412 18:79886181-79886203 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581432 18:79886238-79886260 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581452 18:79886295-79886317 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581472 18:79886352-79886374 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581492 18:79886409-79886431 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581508 18:79886458-79886480 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581528 18:79886515-79886537 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581548 18:79886572-79886594 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581568 18:79886629-79886651 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581585 18:79886686-79886708 CAAGACAGGGAGATGGGGATGGG + Intronic
1160581601 18:79886735-79886757 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581621 18:79886792-79886814 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581641 18:79886849-79886871 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581661 18:79886906-79886928 CGGGACAGGGAGATGGGGATGGG + Intronic
1160581678 18:79886963-79886985 CAAGACAGGGAGATGGGGATGGG + Intronic
1160581697 18:79887020-79887042 CGGGACAGGGAGATGGGGATGGG + Intronic
1160745732 19:709967-709989 GAGCACCGGGAGGAGGGGACCGG - Intronic
1160878397 19:1308499-1308521 CAGCCCAGGGAGAATGAGGCTGG + Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161684251 19:5695245-5695267 CAGCACATGAGGAAGGGGACTGG + Intronic
1161737943 19:6002957-6002979 CAACACAGGGAGGAGGGAGCAGG + Intronic
1161752608 19:6109319-6109341 GGTCACAGGGAGAAGGGGAGGGG + Intronic
1161827355 19:6577174-6577196 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1161865234 19:6828363-6828385 CCCCGCAGGGAGAAGGGGAGGGG + Intronic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1162367209 19:10256830-10256852 CAGGACAGGGTGGAGGGGGCGGG + Intronic
1162560954 19:11418192-11418214 CGGGAGAGGGAGTAGGGGACAGG - Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163636090 19:18437792-18437814 CGGCTCGGGGAGAAGGGCACGGG - Intronic
1165061975 19:33209260-33209282 CAGCACAGGGGGCCGGGGCCTGG - Intronic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1165994032 19:39832255-39832277 CATCACAGGGAAAGGAGGACAGG + Intronic
1166223017 19:41377521-41377543 CAGCACTGGGGGTAGGGGATGGG + Intronic
1166411381 19:42557666-42557688 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1166498450 19:43323614-43323636 CAGCAAAGGGAGATAGGGATGGG + Intergenic
1167596884 19:50432645-50432667 AATCTCAGGGAGGAGGGGACTGG - Intergenic
1168135433 19:54348051-54348073 CAGCGAAGGGAGATGGGGAAGGG + Intergenic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1168558514 19:57363739-57363761 CAGCACTGGAAGGAGGGGTCGGG - Exonic
1168567273 19:57435621-57435643 CAGCACTGGGAGGAGGGGTTGGG - Intronic
925153835 2:1635287-1635309 CAGCACAGGTAGGCGGGGAGGGG + Intronic
925434119 2:3821053-3821075 CAGCAAAGGGAGATAGGGATGGG + Intronic
925598973 2:5588707-5588729 CAGCTCTGGGAGAAGGCTACTGG - Intergenic
925999657 2:9319988-9320010 CAGGGCAGGGAGTAGGGCACAGG + Intronic
926138188 2:10352267-10352289 CAGAACAGTGAGATGGGGAGAGG - Intronic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926226681 2:10971790-10971812 GAGCTCAGGGAAGAGGGGACAGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
927173869 2:20392012-20392034 CAGCAGAGGTACAAGGGGGCTGG - Intergenic
927243162 2:20936105-20936127 GATCACAGGGAGTAGGGGCCTGG + Intergenic
928168539 2:28988461-28988483 CAGCTGAGGGAGAAGGGCACAGG - Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
929004347 2:37381116-37381138 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
929440920 2:41965348-41965370 CAGGACTGGGGGAGGGGGACAGG - Intergenic
929684632 2:44023119-44023141 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
930567199 2:53035799-53035821 GAGCACAGGTGGAAGGGGAATGG + Intergenic
930954670 2:57192608-57192630 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
930954784 2:57193371-57193393 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
931982397 2:67707946-67707968 CAGCAGAGGGAAAGGGGGAAAGG - Intergenic
932672989 2:73754282-73754304 CATCACAGGGAGACAGGGTCAGG - Intergenic
933952341 2:87341858-87341880 CAGCACCCGGAGACGGGGGCTGG + Intergenic
934168792 2:89321730-89321752 CAGCAAAGGGAAAAGGGAAAGGG - Intergenic
934198499 2:89860854-89860876 CAGCAAAGGGAAAAGGGAAAGGG + Intergenic
934236584 2:90238197-90238219 CAGCACCTGGAGACGGGGGCTGG + Intergenic
934504721 2:94880975-94880997 AAGCACATGGAGAGGGGGACTGG + Intergenic
935588928 2:104827279-104827301 CGAAATAGGGAGAAGGGGACCGG + Intergenic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
935745640 2:106188235-106188257 GTGGACAGGGAGAAGGGGAAGGG + Intronic
936075627 2:109399910-109399932 CAGCGCAGGGAGAAATGGAGTGG - Intronic
936985812 2:118310614-118310636 CAGCGCAGGAAGAAGGGGTGAGG + Intergenic
937200757 2:120203221-120203243 AAGCACAGTTAGAAGGGGAGGGG + Intergenic
937276852 2:120690459-120690481 GAGGTCAGGGAGGAGGGGACGGG + Intergenic
938099688 2:128490315-128490337 CAGCAAAGGGAAATGGGGAAGGG - Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938579449 2:132633187-132633209 GAGCACAGGGAGTTGGGGAAAGG + Intronic
938917761 2:135960194-135960216 CAGCACTGGGAGATAGGGAGAGG + Intronic
939461003 2:142495039-142495061 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
939519810 2:143215540-143215562 CAGCTCAGGGAGAAGGGTGTGGG + Intronic
939788006 2:146540170-146540192 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
940030979 2:149260902-149260924 CAGCAGAGGGAAAAGGTAACTGG - Intergenic
940316884 2:152335789-152335811 CGGCACGGGGTGAAGGGGAGGGG - Intronic
940508203 2:154582740-154582762 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940851428 2:158691055-158691077 GAGCACAGGGAAAGAGGGACAGG + Intergenic
940858306 2:158747089-158747111 CATCCCAGGGAGAAAGGGATTGG + Intergenic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
941849243 2:170162568-170162590 CATCACAGGGAAAAGGGGAGTGG - Intergenic
942086525 2:172449159-172449181 CTGCACAGTGGGAAGGGCACTGG + Intronic
942235208 2:173897447-173897469 GAGCACAGCGAGTAAGGGACAGG + Intergenic
943675909 2:190716337-190716359 TAGGACAGGGAGAAGGGAAAAGG + Intergenic
944019638 2:195086715-195086737 TAGCAGAGGGTGATGGGGACTGG - Intergenic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
944975285 2:205042820-205042842 CAGGACAGGGAGAAGGGATGAGG - Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
946122324 2:217527029-217527051 GTGCACAGTGAGAAGGGGAGGGG - Intronic
946444680 2:219728162-219728184 TAGCTCAGGGAGCAGGGGAAGGG - Intergenic
946726939 2:222670918-222670940 CAGCGAAGGGAGATGGGGAAGGG - Intergenic
946940094 2:224761232-224761254 GAGTAAAGGGAGAAAGGGACAGG + Intergenic
947308717 2:228776780-228776802 CAGGTCAGGGAGAAGGGCACTGG + Intergenic
947824273 2:233093938-233093960 AAGCACAGGGAAAACGGGCCAGG - Intronic
948326088 2:237122471-237122493 CAGCAGAGGGAGAAGAGACCTGG + Intergenic
948465257 2:238149047-238149069 CAGCACAGCGAGGCGAGGACAGG - Exonic
948580012 2:238980620-238980642 GAGCACAGGGAGAGGGGCAATGG - Intergenic
948594368 2:239069990-239070012 CAGGACAGAGAGGACGGGACAGG - Intronic
948653903 2:239465069-239465091 TGGCACAGGGAGAAGGGAAGGGG + Intergenic
948779672 2:240310933-240310955 CACCACATTGAGAAGGAGACTGG - Intergenic
948806482 2:240455462-240455484 CTGCACGGGGGGAAGGGGATGGG + Intronic
949008770 2:241666872-241666894 AAGAACTGGGAGAAGGGGACGGG - Intronic
1168839661 20:901475-901497 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1169021850 20:2336227-2336249 CAGCCCAGGGTGAAGGGTGCTGG + Intronic
1169075895 20:2759643-2759665 CAGCTCAGGGAGAAGTGACCTGG + Exonic
1169325284 20:4670731-4670753 GAGCACAGGGAGAATGGGGGAGG + Intergenic
1169947005 20:10999777-10999799 CAGAACTGGCAGAAGTGGACAGG - Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170335679 20:15267753-15267775 GAGCACTGGGAGGATGGGACGGG + Intronic
1170504241 20:17008374-17008396 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172298601 20:33831944-33831966 CAGCAAGGGGTGAAGGGCACAGG - Intronic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1172519808 20:35559275-35559297 CATCACTGGGAGCAGGGGGCGGG + Intergenic
1172931940 20:38592497-38592519 CAGCAAAGGGAGATGGGGGTGGG + Intergenic
1173091458 20:39975972-39975994 CAGCCCAGGGGGAAAGGGCCAGG + Intergenic
1173730527 20:45325385-45325407 CAGCCCAAGGGGAAGGGCACTGG + Exonic
1174100859 20:48125217-48125239 CAACACAGGGAGGAGAGGTCTGG - Intergenic
1174500496 20:50980850-50980872 TGGCACAGGGAGGTGGGGACTGG + Intergenic
1174554003 20:51381157-51381179 GAGGACAGGCAGAAGGGGAAAGG + Intergenic
1175459206 20:59138445-59138467 AAGCACAGTGATCAGGGGACGGG - Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1175707613 20:61192693-61192715 CAGCAGAGAGAGAAAGAGACAGG - Intergenic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1176233015 20:64041603-64041625 CCGCACTGGGAGGAGGGGGCCGG + Intronic
1176326640 21:5507452-5507474 AAGCACAGGCAGCAGGGGACAGG + Intergenic
1176331067 21:5548757-5548779 GAGCACAGGCAGCAGGGGACAGG - Intergenic
1176377562 21:6094050-6094072 CAGCACATGGAGAACGCGGCAGG - Intergenic
1176396690 21:6272194-6272216 GAGCACAGGCAGCAGGGGACAGG + Intergenic
1176401117 21:6313499-6313521 AAGCACAGGCAGCAGGGGACAGG - Intergenic
1176436040 21:6675605-6675627 AAGCACAGGCAGCAGGGGACAGG + Intergenic
1176440467 21:6716910-6716932 GAGCACAGGCAGCAGGGGACAGG - Intergenic
1176460302 21:7002675-7002697 AAGCACAGGCAGCAGGGGACAGG + Intergenic
1176464729 21:7043979-7044001 GAGCACAGGCAGCAGGGGACAGG - Intergenic
1176483863 21:7384453-7384475 AAGCACAGGCAGCAGGGGACAGG + Intergenic
1176488290 21:7425758-7425780 GAGCACAGGCAGCAGGGGACAGG - Intergenic
1176621337 21:9064223-9064245 AAGCACATGGAGAGGGGGACTGG - Intergenic
1177798666 21:25806068-25806090 CAGCACTGGGAGATGGTGCCTGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178370098 21:32020378-32020400 CAGCCCAGGGAGAGGGAAACTGG - Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179062075 21:37988530-37988552 CAGCAAAGGGAGATGGGGGTGGG - Intronic
1179265319 21:39797814-39797836 CAGCAAAGGAAGTAGGGGTCAGG - Intronic
1179281742 21:39939616-39939638 CAGCACCAGGAGAATTGGACAGG - Intergenic
1179522942 21:41957072-41957094 CTGCAGTGGGAGAAGGGGACTGG - Intergenic
1179557386 21:42188521-42188543 TAGCCCAGGGAGAAGGGGGCTGG + Intergenic
1179820359 21:43933697-43933719 CAGCACAGGGGAAAGGTGAGGGG + Intronic
1179821368 21:43939248-43939270 CAGCACACGGGGACGGGGATGGG - Intronic
1179831575 21:44000406-44000428 CTGCAAAGGGAGGAGGGGAGTGG + Intergenic
1180211033 21:46295641-46295663 CAGCACAGGGAGTGCGGGAGAGG - Intronic
1180799427 22:18624889-18624911 CAGGACAGGCAGGAGGGCACAGG - Intergenic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1181222291 22:21370377-21370399 CAGGACAGGCAGGAGGGCACAGG + Intergenic
1181279660 22:21710082-21710104 CAGCACAGTAAGGAGGGGCCAGG + Intronic
1181638050 22:24183370-24183392 CAGGACAGGCAGGAGGGCACAGG + Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181937307 22:26448175-26448197 CAGCACAGGGAGAAGGACCTGGG - Intronic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182857127 22:33527708-33527730 CAGCACAAAGAGAAAGTGACTGG + Intronic
1183186496 22:36294455-36294477 CAGCTAAGAGAGAAGAGGACAGG - Intronic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183535049 22:38396640-38396662 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1183709877 22:39496744-39496766 CAGCACAATGAGAAGGGTATTGG - Intergenic
1184259513 22:43306610-43306632 AAGCACAGGGAGAGTGGGAAGGG + Intronic
1184680870 22:46071572-46071594 GAACCCAGGGAGGAGGGGACGGG - Intronic
1184769581 22:46589479-46589501 CTGCCCAGGGAGAAGGTGAGTGG + Intronic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1184992705 22:48181674-48181696 AAGCACAGGGAGGAGGGCAGGGG + Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949592471 3:5508821-5508843 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
949928851 3:9062357-9062379 CAACATAGGGAGAAGGAGAGAGG - Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
952869482 3:37885701-37885723 TAGCAAAGGGACAAGGGGTCTGG + Intronic
953335364 3:42089706-42089728 CAGGAAAGGGAGATGGGGAAAGG - Intronic
953840668 3:46387787-46387809 CAGCAAAGGGAGATAGGGATGGG + Intergenic
954583780 3:51717844-51717866 CTGGACAGGGAGAGGGGAACAGG - Intronic
954602090 3:51877931-51877953 CAGCACAGGGAGCAAGACACAGG + Intergenic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
954607996 3:51928780-51928802 CAGCACAGGGAGCAAGACACAGG + Intergenic
955396618 3:58562295-58562317 CAGCAAAGGGAGATGGGGTGAGG - Intergenic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956289544 3:67647122-67647144 AAGCACAGGGAGAAATGGATGGG + Intronic
956365369 3:68496282-68496304 CAGCCCAGGTTGAAGGGGAGAGG - Intronic
956549255 3:70440106-70440128 CAGCAAAGGGAGATAGGGATGGG + Intergenic
956576852 3:70761313-70761335 AAGCAGAGTGAGAAGGGGATGGG + Intergenic
956782820 3:72617790-72617812 GAGCACTGGGAGAAGTGGGCAGG - Intergenic
957080812 3:75634129-75634151 CAGCATAGGCAGCGGGGGACAGG - Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957893269 3:86387164-86387186 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
959903467 3:111685084-111685106 CAGAATTGGGAGAAGGGCACAGG + Intronic
959973385 3:112431847-112431869 CAGCACAGGGACCCTGGGACTGG - Intergenic
960158121 3:114318428-114318450 AAGCAGAGGGTGAAGGAGACAGG + Intergenic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961022613 3:123521660-123521682 CACCACAGGGAGGAGGGTGCAGG + Intronic
961349022 3:126287399-126287421 CCGGACAGGGAGCGGGGGACTGG - Intergenic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
962246397 3:133797923-133797945 TAGAAGAGGGAGAAGGGGAAGGG + Intronic
962481644 3:135803215-135803237 TAGCGGAGGGGGAAGGGGACAGG - Intergenic
962544828 3:136422767-136422789 CAGCACAGGTAGAATGGAAAAGG - Exonic
962628153 3:137248249-137248271 CAGCACAGTGAGGAAGGTACTGG - Intergenic
962660347 3:137595925-137595947 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
963234627 3:142945019-142945041 CAGCTCCTGGAGAAGGGGAAGGG + Intergenic
964108363 3:153063159-153063181 CAGCAGAGGGAGAGGGGAAGTGG - Intergenic
964941054 3:162158231-162158253 CAGCCTAGGGAGGAGGGGAGAGG + Intergenic
964984121 3:162718136-162718158 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
965862069 3:173159995-173160017 CAGCCTAGAGAGAAGGGGAGAGG + Intergenic
966055239 3:175678954-175678976 CAGCAAAGGGAGACAGGGATGGG + Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967005465 3:185378605-185378627 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
967495912 3:190144886-190144908 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
967812181 3:193769682-193769704 CAGCAGAGGGAGAGGGGCAAGGG + Intergenic
967890411 3:194360598-194360620 CTGCACTGGGAGAAGTGGGCCGG + Exonic
968413415 4:407930-407952 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
968473121 4:791052-791074 CAGGAGCGGGAGACGGGGACAGG - Intronic
968581447 4:1397187-1397209 GAGCACAGGGAGGAAGGGGCAGG - Intergenic
968813941 4:2812227-2812249 CTGCCCAGGGAGCAGGGAACAGG + Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968993074 4:3927732-3927754 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
969027420 4:4184688-4184710 CAGCGTAGTGAGAAGGGGAGGGG - Intergenic
969173735 4:5384002-5384024 CATCACAGGGAGAGAGGGAGGGG + Intronic
969654203 4:8486900-8486922 CAGCCCAGGGAGGAGGGGAGAGG + Intronic
970853525 4:20629870-20629892 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
971286461 4:25294763-25294785 CAGCCCAAGTAGAAGGGGAGTGG - Intergenic
971395574 4:26224172-26224194 GAGTACAGGGGGAAGGGGAGGGG - Intronic
973718462 4:53700601-53700623 CAGCACAGGGACCCTGGGACTGG + Intronic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974849067 4:67384095-67384117 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
975681830 4:76885172-76885194 CAGCACATGGTGAAGGCCACTGG - Intergenic
976087494 4:81421122-81421144 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976271579 4:83235713-83235735 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
976719001 4:88152427-88152449 CAGCAAAGGGAGATAGGGATGGG + Intronic
977041674 4:92026117-92026139 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
977157128 4:93588712-93588734 CAGTACTGGGAGAAGGGGCAGGG - Intronic
977822105 4:101485185-101485207 GGGCACAGAGAGAAGAGGACAGG + Intronic
978150810 4:105432587-105432609 CAGTAGAGGCAGAAGGGGATAGG + Intronic
978192721 4:105933792-105933814 AAGGAGAGGGAGAAGGGAACTGG - Intronic
978237916 4:106482374-106482396 CAGCACAGAGAGGAGGAGACAGG + Intergenic
978802413 4:112767996-112768018 AAACAAAGGGAGAAGGAGACAGG + Intergenic
980202751 4:129677126-129677148 CAGCACAGGGACACTGGGCCTGG - Intergenic
980593130 4:134917333-134917355 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
980829521 4:138113026-138113048 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
981193165 4:141887049-141887071 CAGGATAGGGTGAATGGGACTGG + Intergenic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
982318532 4:154056830-154056852 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
982722780 4:158876583-158876605 CAGAACAGGGATATGGGGCCTGG - Intronic
984574119 4:181427698-181427720 CATGACAGGGAGAAAGAGACGGG + Intergenic
985450097 4:190057079-190057101 CAGCACAGGCAGCGGGGGACAGG + Intergenic
985671186 5:1207416-1207438 CAGCACCCAGAGAAGGGGCCTGG - Intronic
985887263 5:2689147-2689169 CAGCACAGGAAGGAGGTGGCTGG + Intergenic
986174054 5:5336969-5336991 CAGCACAGGGAGGAGGGACGAGG + Intergenic
987679603 5:21118035-21118057 CAGCAAAGGGAGATAGGGATGGG + Intergenic
989028023 5:37088711-37088733 CACCACAGGGAGCACAGGACTGG + Intergenic
989615407 5:43333093-43333115 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
991662124 5:68961230-68961252 CAGCACAGAGCGAAGAGGAAGGG - Intergenic
992034928 5:72763668-72763690 CATCCCAGGAAGAAGGGGACAGG - Intergenic
992175585 5:74146194-74146216 CAGCCCAGGGACAAGGGCAGGGG + Intergenic
992452152 5:76884812-76884834 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
992864514 5:80943823-80943845 CAGCTCATTGAGAACGGGACGGG - Intergenic
994324561 5:98434829-98434851 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
995125299 5:108572874-108572896 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
995414070 5:111889791-111889813 CAGCAAAGGGAGATGGGGTGGGG + Intronic
995471100 5:112503083-112503105 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
997293842 5:132757364-132757386 CTGCTCAGGGAGAAGTGGAGGGG - Intronic
997360550 5:133292048-133292070 CAGCCCATGGAGATGGGCACTGG + Intronic
997443530 5:133925512-133925534 CAATACAGTGAGGAGGGGACAGG - Intergenic
997497848 5:134345565-134345587 CAGCAAAGGGAGATGGGGTGGGG + Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998143176 5:139711138-139711160 CAGCCCAGGGAGCTGGAGACAGG + Intergenic
998285032 5:140850814-140850836 CAGCACAAGGAGAAAGGCCCGGG - Exonic
998363678 5:141613954-141613976 AAACACAGGGAGGAGGTGACAGG + Intronic
998404704 5:141867761-141867783 CAGCCCATGGGGAAGGGGAAAGG + Intronic
999282068 5:150372575-150372597 CAGCAGATGGGGAAGGGAACTGG - Intronic
999663698 5:153891535-153891557 CAGCTCAGGGAGTCAGGGACAGG + Intergenic
1000519504 5:162279431-162279453 CAGCCCGGGGAGGAGGGGAGAGG + Intergenic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1000884953 5:166740154-166740176 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1001136785 5:169109052-169109074 CAGCATATGGAAAAGGGGATGGG + Intronic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001922041 5:175608506-175608528 CAGCTCTGGGAGAGGGGGCCTGG - Intergenic
1002104893 5:176875160-176875182 CCGCTCGGGGAGAAGGGCACTGG - Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002187232 5:177460026-177460048 CAGCACACTGAGAAGCGGAACGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002862384 6:1091637-1091659 CAGACCAGGGAAAAGGGGAAAGG - Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003748289 6:9026493-9026515 TGGCACAGGGAGACGGGGAGCGG + Intergenic
1003892495 6:10575931-10575953 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1004245251 6:13969248-13969270 CAGGACAGGGACCAGGGGAAGGG - Intronic
1004278225 6:14256888-14256910 CAGCACAGGGAGAGGTGTGCGGG + Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1004649200 6:17592258-17592280 GAGCAGAGTGAGAGGGGGACAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005284643 6:24312200-24312222 CAGCAAAGGGAGATGGGGTGAGG - Intronic
1005785853 6:29245578-29245600 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1006200489 6:32284595-32284617 CAACACATGGACACGGGGACGGG + Intergenic
1006397483 6:33796684-33796706 CGGCACAGGCAGAACTGGACTGG - Intronic
1006945775 6:37783666-37783688 CAGCACAGGGAGGGGCGGAGAGG - Intergenic
1007272130 6:40645887-40645909 CAGCACATGTAGAAGGGGAGGGG + Intergenic
1007278484 6:40692908-40692930 AATCACAGGGAGAAGGTGATGGG + Intergenic
1007285418 6:40744126-40744148 GAGCACAGGGAGCATGGAACTGG + Intergenic
1007300104 6:40861498-40861520 CAGCAAAGGGAGAGAGGGATGGG + Intergenic
1007766613 6:44164327-44164349 CAGGATAGGGAGTAGGGGAGGGG + Intronic
1010905756 6:81486111-81486133 CAGCATGGGGAGCTGGGGACCGG - Intergenic
1012689892 6:102297206-102297228 CAGCAAAGGGAGATGGGGGGGGG - Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013619128 6:111872380-111872402 CAGCACAGGGGAAAGGGGAAGGG + Intronic
1014115449 6:117663774-117663796 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1015880099 6:137863764-137863786 CAGTGCAGGGAAAAGGGGAGGGG + Intergenic
1016341372 6:143064911-143064933 CAGCGAAGGGAGATGGGGAAGGG + Intronic
1016798856 6:148147531-148147553 CAATACAAGGAGAAGGGGAAGGG + Intergenic
1016945386 6:149527626-149527648 AGGCACAGGGAGAATGGGATAGG - Intronic
1017128736 6:151090292-151090314 CAGCACAGGGAAAGGGAGACTGG - Intronic
1017157328 6:151333926-151333948 CAGCACAGGAAGAAGGGTCCTGG + Intronic
1017170550 6:151450708-151450730 CAGCTCATTGAGAACGGGACGGG + Intronic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1017841609 6:158226990-158227012 CAGCACAGGGATAGGGAAACTGG - Intergenic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018415864 6:163601692-163601714 GAGGACAGGGAGGAGGGGAGAGG - Intergenic
1018495803 6:164344470-164344492 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018778905 6:167044748-167044770 CAGCCCTGGGAGGAGGGGCCGGG + Exonic
1019181135 6:170187841-170187863 CAGCTCAGGGACAAGGGGCCCGG - Intergenic
1019267331 7:125209-125231 CAGCACAGGGTGGAGGGGCCAGG - Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019402975 7:866782-866804 AGGCCCAGGGAGAAGGGGGCGGG - Intronic
1019612700 7:1944985-1945007 AAGCAGAGGGAGACGGGTACGGG + Intronic
1020013354 7:4818010-4818032 CAGCACCTGGGGAAGGGGCCAGG + Intronic
1021636992 7:22703644-22703666 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1021637857 7:22709190-22709212 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1022066457 7:26864210-26864232 CGGCACAGGGAGGAGAGGAGAGG - Intronic
1022129945 7:27395786-27395808 CAGCAGGGAGAGAAGGGGGCAGG + Intergenic
1022522576 7:31017586-31017608 CAGCAGAGGGAGGAAGGGAGAGG + Intergenic
1022708787 7:32832894-32832916 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1022844053 7:34192154-34192176 CAGCCCAGTGAGAACTGGACTGG + Intergenic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023093003 7:36633635-36633657 CAGGACGGGGAGCAGGGGCCTGG + Intronic
1023120486 7:36903752-36903774 CAGCACAGAGGGAAGGGTGCAGG - Intronic
1023592060 7:41790977-41790999 CAACACTGGGAGAAGAGGGCCGG - Intergenic
1024123792 7:46271155-46271177 GAGCCCAGGGAGATGGGGCCAGG + Intergenic
1024565354 7:50675798-50675820 CAGCACATGGAGATGGGGAGGGG + Intronic
1024690917 7:51802630-51802652 AAGCACAGTCAGAAGCGGACTGG - Intergenic
1025854786 7:65267398-65267420 GAGCACAGGCAGCAGGGGACAGG - Intergenic
1025986963 7:66462493-66462515 CAGCAAAGGGGGAAGTGGAAAGG - Intergenic
1026888614 7:73969275-73969297 CAGCACAGGGATTTGGGGCCAGG + Intergenic
1028441986 7:90874120-90874142 CAGCTCAGGGAAGAGGGGAAGGG - Intronic
1028726223 7:94090767-94090789 CAGCACAGGGCGGAGGTGACCGG - Intergenic
1028752125 7:94393908-94393930 GAGCCCATGGAGAAGGGGAGGGG + Intergenic
1029361975 7:100094367-100094389 CAGAAGAGGGAGATGGGGAAGGG + Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1030032661 7:105383949-105383971 CAACGCAGGGGGAAGGGGAATGG + Intronic
1030543133 7:110858413-110858435 TAGCAGAGGGGGAGGGGGACAGG + Intronic
1030933155 7:115550587-115550609 CACCCCTGGGAGATGGGGACCGG + Intergenic
1031296354 7:120009506-120009528 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1031633648 7:124075196-124075218 AAGCAAAGGGAGAAGGAGAAGGG - Intergenic
1031776995 7:125917844-125917866 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1032369099 7:131328195-131328217 GAGCCCAGGGAGAAGGGGCGAGG + Intronic
1032429534 7:131849572-131849594 CAGCTCAGGGACAAGGGGAAAGG + Intergenic
1032922729 7:136567444-136567466 AGGCACTGGGAGAAGGGCACAGG - Intergenic
1033084613 7:138330651-138330673 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1033460315 7:141541608-141541630 GAGCCCAGGGAGAAGGAGGCAGG - Intergenic
1034017352 7:147601300-147601322 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034084249 7:148309517-148309539 CAGCAAAGGGAGATGGGGTGGGG + Intronic
1034098912 7:148435397-148435419 CAGCACAAGGGGAGGGGAACTGG + Intergenic
1034370034 7:150587021-150587043 CACCACAGGGCAAAGGGGAAAGG - Intergenic
1034405923 7:150902359-150902381 CAGCAGAGAGTGAAGGAGACAGG + Intergenic
1034434271 7:151055678-151055700 GAGCACAGAGGGAAGAGGACTGG - Intronic
1034448554 7:151125711-151125733 TAGAACCGGGAGAACGGGACAGG - Intronic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1034996438 7:155580199-155580221 CAGCACAGAGAGGAAGAGACTGG + Intergenic
1035068495 7:156124555-156124577 CAGCACAAGGAGGTGGGGGCGGG - Intergenic
1035121985 7:156576558-156576580 GAGCCCAGGGGGAAGGGGAAGGG - Intergenic
1035690554 8:1556933-1556955 CAGCACAGCGGGATGGGGGCTGG + Intronic
1035727467 8:1833796-1833818 CAGCACAGGGAGCTGGGGATGGG - Intronic
1036621015 8:10424591-10424613 AGGGACAGGGAGAAGGGGCCAGG + Intronic
1037524758 8:19713861-19713883 CCCCAGATGGAGAAGGGGACTGG + Intronic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038963726 8:32548927-32548949 GAGCGCAGGGCGAAGAGGACGGG - Intronic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1039669460 8:39580326-39580348 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1039836993 8:41264567-41264589 CAGCAAAGGGACCAGGGGAGAGG - Exonic
1040003911 8:42601903-42601925 CAGCACTGGGAGATGGAGATGGG - Intergenic
1041260956 8:56020143-56020165 AAGCACAGGGAGAAGGCCTCGGG - Intergenic
1041380245 8:57247476-57247498 CAGGACAGGGAATAGGGTACAGG - Intergenic
1041917644 8:63152392-63152414 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1043596910 8:81898119-81898141 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043717377 8:83504804-83504826 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1043838250 8:85069030-85069052 CAGCAAAGGGAGATGGGGGTGGG - Intergenic
1045265692 8:100617031-100617053 CAGCAGATGGAAAAGGGGTCTGG + Intronic
1045381468 8:101631673-101631695 CAGAACAGGAAGAAAGGGAAAGG + Exonic
1045824434 8:106380116-106380138 TAGGACTGGGAGAAGGGGAAGGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1045958916 8:107943916-107943938 GAACAGAGGGAGAGGGGGACGGG + Intronic
1046550544 8:115710248-115710270 CAGCAAAGGGAGATGGGGTGGGG - Intronic
1046934790 8:119875284-119875306 CAGCAAAGGGAGATGGGGAAGGG + Intronic
1047211229 8:122842065-122842087 GGGCACAGTGAGAAGGGCACTGG + Intronic
1047434773 8:124827157-124827179 CAGCTCAGGGAAAACGGCACTGG - Intergenic
1047443209 8:124897470-124897492 CAGCAAAGGGAGATAGGGATGGG + Intergenic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048440290 8:134454628-134454650 CGCCACAGGGAGAACGGCACTGG - Intergenic
1048862139 8:138731418-138731440 CAGCACTGGAAGAAGGTGATAGG + Intronic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049245229 8:141558874-141558896 CAGCACCGCGAGAAGGTGAGAGG - Intergenic
1049642364 8:143721450-143721472 CAGCACAGGCAGAAGGGGCCCGG - Intronic
1050310672 9:4350095-4350117 CAGCATAGTGAGAAGGGATCAGG + Intergenic
1050458481 9:5856584-5856606 CCGCACAGGGCTAAGGGGAGGGG - Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051674713 9:19547346-19547368 CTGCACAGGGAGCAGTGGACTGG + Intronic
1052560525 9:30078325-30078347 CAGCACTGAGAGAATGAGACAGG + Intergenic
1055574001 9:77644852-77644874 CAGCATAGGGAGAAAGTGTCAGG - Intronic
1056271583 9:84953054-84953076 CAGCACCAGGAGAAGGGGCTGGG - Intronic
1056276612 9:84999943-84999965 AAGCACAGCGAGGAGAGGACAGG + Intronic
1056363174 9:85879331-85879353 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1056852874 9:90098689-90098711 CACCACAGGGAGGAGAGGAGCGG - Intergenic
1057446733 9:95121320-95121342 CAGAACAGGGACAAGAGGAAAGG + Intronic
1058060984 9:100495874-100495896 CAGCACAGGAAGAAAAAGACAGG - Intronic
1059267069 9:113044529-113044551 AAACACAGGGAGAAGTGAACAGG + Intronic
1059715237 9:116907240-116907262 CAGGCCAGGGAAAAGGGAACGGG - Intronic
1059738958 9:117130875-117130897 GTGCTCAGGGAGAAGGGGAAGGG - Intronic
1060229454 9:121815857-121815879 CAGCACAGAGCGGAGGGGGCTGG + Intergenic
1060588173 9:124799680-124799702 CAGCACAGGGAATGGGGGATAGG + Intronic
1060879631 9:127108971-127108993 CAGCAGAGGTAGAAGGGAAGAGG + Intronic
1060919937 9:127413539-127413561 CAGCAAAGGGAGATGGGGTGGGG - Intergenic
1060998974 9:127891714-127891736 GAGGAGAGGGAGAAGGGGAGGGG + Intronic
1061176773 9:129002344-129002366 CAGGACTGGGAGAAGGGAAGTGG + Intronic
1061277730 9:129579075-129579097 CTCCACAGGGAAAAGGGGTCTGG + Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061820591 9:133225443-133225465 CAGAACCGGGAGAACGGGAAGGG + Intergenic
1061889679 9:133611601-133611623 CAGCATGGGGAGAAGTGGAAGGG - Intergenic
1061943496 9:133895119-133895141 CAGCACAAGGGGCAGGGGAGGGG + Intronic
1062238673 9:135524615-135524637 CAGAACCGGGAGAACGGGAAGGG - Intronic
1062254586 9:135614943-135614965 CAGCAAGTGGGGAAGGGGACTGG + Intergenic
1062503801 9:136862655-136862677 CAGCACAGGCTGACGGGAACTGG + Intronic
1062665717 9:137670434-137670456 CAGCACCGGGGGGAGGGGGCAGG - Intronic
1062722289 9:138050744-138050766 CAGCTGAGGGAAGAGGGGACAGG - Intronic
1203431035 Un_GL000195v1:91569-91591 GAGCACAGGCAGCAGGGGACAGG + Intergenic
1203435477 Un_GL000195v1:133055-133077 AAGCACAGGCAGCAGGGGACAGG - Intergenic
1203744539 Un_GL000218v1:34693-34715 AAGCACATGGAGAGGGGGACTGG - Intergenic
1203565563 Un_KI270744v1:84791-84813 AAGCACATGGAGAGGGGGACTGG + Intergenic
1185485341 X:477667-477689 GAGCACAGGCAGACGGGTACAGG + Intergenic
1185960207 X:4540577-4540599 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1186447079 X:9640254-9640276 CAGCCTAGGGAGAAAGGGAAAGG - Exonic
1186459961 X:9740081-9740103 CAGCAGTGGGAGAAGGGGAGAGG + Intronic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187745511 X:22404690-22404712 CAGCGAAGGGAGATGGGGAAGGG - Intergenic
1187876418 X:23807666-23807688 CATCAAAGGTAGAAGGAGACCGG + Intergenic
1189303520 X:39969804-39969826 CAGCCTAGAGAGAAGGGGAAAGG + Intergenic
1189561367 X:42194563-42194585 GAGGACAGGGAGAAGGACACTGG - Intergenic
1189935835 X:46067316-46067338 CAGCAAAGGGAGATGGGGGTAGG - Intergenic
1190178069 X:48167747-48167769 CACCAGAGGGAGAAGGTGCCAGG + Intergenic
1190291771 X:48997730-48997752 CAGAACAGGGAGAAGAGGAGGGG + Intronic
1190713884 X:53088243-53088265 CAGCACAGGGAGAGGGGCTGGGG - Exonic
1191029453 X:55952178-55952200 CAGCAAAGTGAGGAGGTGACTGG + Intergenic
1192706041 X:73529285-73529307 CAGCTTAGGGAGGAGGGGAGAGG - Intergenic
1192731910 X:73809121-73809143 CAGCAAAGGGAGATAGGGATGGG + Intergenic
1193536957 X:82728174-82728196 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194200979 X:90952516-90952538 CAGCAAAGGGAGATGGGGTGGGG + Intergenic
1194660359 X:96624310-96624332 CAGCAGAGGGAGATGGGGTGGGG - Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197077924 X:122375368-122375390 CAGCTGAGGCAGAAGGGGAGAGG + Intergenic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197464058 X:126782132-126782154 CAGCAAAGAAAGAAGGGGAAAGG - Intergenic
1197499623 X:127228215-127228237 CAGCATGGGGAGGAGGGGAGAGG - Intergenic
1197890945 X:131269794-131269816 CAGCACAGAGTAAAGAGGACAGG - Intergenic
1198965823 X:142228168-142228190 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1199452523 X:147992146-147992168 CAGCTCATTGAGAACGGGACGGG - Intronic
1199704001 X:150408216-150408238 CATCACTGGGAGAGGGTGACTGG + Intronic
1199904033 X:152206554-152206576 CAGCACAGTGAGCCAGGGACGGG + Intronic
1200087636 X:153616533-153616555 CAGCAATGGGACAAGGGGACTGG + Intergenic
1200759189 Y:7021430-7021452 CAGCCTAGGGAGAAAGGGAAAGG - Exonic
1200812712 Y:7502010-7502032 CAGCCCAGGGACAAGGGGAGAGG - Intergenic
1201157871 Y:11149676-11149698 AAGCACATGGAGAGGGGGACTGG - Intergenic
1201284673 Y:12368923-12368945 CAGCGAAGGGAGATGGGGATGGG + Intergenic
1201362191 Y:13164595-13164617 CAGCAAAGGGAGATGGGGTAGGG + Intergenic
1201581837 Y:15517950-15517972 CAGCAAAGGGAGATAGGGATGGG - Intergenic
1202062864 Y:20905607-20905629 CAGCAAAGGGAGATAGGGGCGGG - Intergenic