ID: 1003344114

View in Genome Browser
Species Human (GRCh38)
Location 6:5249847-5249869
Sequence TGGGATTCAGTGTGAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003344109_1003344114 28 Left 1003344109 6:5249796-5249818 CCAGTTGATTGGGGAAATACTAA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG 0: 1
1: 0
2: 2
3: 30
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003344114 Original CRISPR TGGGATTCAGTGTGAAGAAA GGG Intronic
900865235 1:5264133-5264155 TGGGATTCACTGTGATCATAGGG - Intergenic
901259373 1:7860401-7860423 TGTGGTTCAGTGTGATCAAAGGG + Intergenic
902659219 1:17889826-17889848 TGGGAGTCAGAGAGAAGAAAGGG - Intergenic
902854636 1:19192309-19192331 TGAGGTTCAGTATGAGGAAAAGG + Exonic
903358508 1:22762608-22762630 TGGGATTCAGTGAGGGGAAGGGG - Intronic
904040325 1:27580498-27580520 TAGGATTCAGGAAGAAGAAATGG - Intronic
904565973 1:31428713-31428735 AGGAATTCAGTGTGATGAGATGG + Intronic
905033198 1:34901136-34901158 TGGGATTCAGTGGGGAGATCGGG + Intronic
905788686 1:40778530-40778552 TGGGATTCAGGGAGGAGAATGGG - Intergenic
906155719 1:43612916-43612938 TGGGATTGGGGGAGAAGAAAGGG - Intronic
906585039 1:46968328-46968350 GTGGCTTCAGTGTGGAGAAAGGG - Intergenic
907680794 1:56561424-56561446 TGTAAGTCAGTGTGATGAAATGG - Intronic
907844481 1:58191390-58191412 TGGGATTCCGATTGAAAAAAAGG - Intronic
909157571 1:72097968-72097990 TTTGCTTCAGTGTAAAGAAAGGG - Intronic
909709580 1:78632017-78632039 TGATATTCAGTGTGATAAAATGG + Intronic
910778645 1:90902333-90902355 TAATATTCTGTGTGAAGAAATGG - Intergenic
911021746 1:93396371-93396393 TGGAATTCAGTGTGAAAATGGGG - Intergenic
911210080 1:95129728-95129750 TGAGATTCTGTGTCAAGAAAGGG + Intronic
911873004 1:103122998-103123020 TTGGCAGCAGTGTGAAGAAATGG + Intergenic
913185903 1:116371000-116371022 TGTGTTCCGGTGTGAAGAAAGGG - Intergenic
913496391 1:119432014-119432036 TGTGATTCAGTGGAAAGATAAGG - Intergenic
915963532 1:160286301-160286323 TTGGGTTCTGTGTGGAGAAAAGG - Intronic
916365550 1:164023144-164023166 TGGGATCCAGTTCGAAGAAATGG - Intergenic
916560329 1:165929406-165929428 TGGAATTCCGTGTGAAGATTTGG + Intergenic
918708015 1:187692528-187692550 TGGGAATGAGTCTGTAGAAATGG - Intergenic
919161639 1:193838076-193838098 TGGGATTCAGAGTAAGCAAAGGG - Intergenic
920963579 1:210684316-210684338 TGGGAGCCAGTGTCAAGAAAAGG - Intronic
922237177 1:223731063-223731085 TGGGAGTCAGTGTGAGGATCTGG + Intronic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
924793633 1:247275954-247275976 TGGAATACAGTGGAAAGAAATGG + Intergenic
1063446301 10:6120002-6120024 TGGGATTCTCTGAGAAGAATGGG - Intergenic
1063518960 10:6723595-6723617 TGGGATTCAGGTTGGAGATAGGG + Intergenic
1063984292 10:11484627-11484649 TGAGATTCAGACTGATGAAAAGG + Intronic
1065124107 10:22556387-22556409 TGGGTTTCAGTTTAAACAAAAGG - Intronic
1066445594 10:35479921-35479943 TTGGCTTCAGTGTGAAGTTAGGG + Intronic
1066736448 10:38484499-38484521 TGGATTTCAGTGGAAAGAAATGG + Intergenic
1066737197 10:38490226-38490248 TGGAATTGAATGTGATGAAAGGG + Intergenic
1067786714 10:49255466-49255488 TGGGACTCATTGTGAAGTTAAGG + Intergenic
1068897288 10:62219979-62220001 TGTGATCCAGTGTGAACTAAGGG - Intronic
1070155821 10:73834604-73834626 TGGGGTTATGTGTTAAGAAAGGG - Intronic
1070605371 10:77894703-77894725 TGGGAATCAGGGAGCAGAAAAGG - Intronic
1071129105 10:82370659-82370681 TGGGATACAGTGAAAAGAATGGG - Intronic
1072078945 10:92008873-92008895 TGGAATTCTGTGTGATGACATGG + Exonic
1073484156 10:103806124-103806146 TGTGACTCAGTGTGAAGGATGGG + Intronic
1074414036 10:113251522-113251544 TGGGCTCCAGTGTGGAGAAGGGG - Intergenic
1074474671 10:113759433-113759455 TGGGATTGGGTGTGCAGAAAAGG - Intronic
1077948441 11:6927567-6927589 TGGGATTCAGGATTAAGACACGG - Intronic
1079168884 11:18073143-18073165 TGGGCATCAGTTTGAAGCAAAGG - Intronic
1079316204 11:19409930-19409952 CAGGATTCAGTGGGAAGAAGTGG + Intronic
1080103646 11:28488832-28488854 TGGGATTCAGAAGGAAGAGATGG - Intergenic
1080598853 11:33802600-33802622 TGGGATTGAGGGTGAAGGAGTGG + Intergenic
1080886009 11:36369044-36369066 TGGGTTTCAGGGTGCACAAAAGG + Intronic
1080932194 11:36823051-36823073 TGGGTTTCAGTTCTAAGAAAGGG + Intergenic
1081419500 11:42856890-42856912 TAGGATTCAGTCAGAAGAAAAGG + Intergenic
1081470026 11:43361056-43361078 TTGGATTTAATCTGAAGAAAAGG + Intronic
1084156780 11:67317612-67317634 TGGGATGCGGAGTGAAGAGAAGG - Intergenic
1084699693 11:70778327-70778349 TGGGATTGTGTGGTAAGAAAGGG + Intronic
1084966630 11:72747981-72748003 TGGTTTTCACTGTGAAGCAATGG + Intronic
1085026764 11:73240859-73240881 TGGGACTCAGTGGGGAGAAAGGG - Intergenic
1085915606 11:80884353-80884375 TGGGACTCAGTGTTTTGAAATGG - Intergenic
1086588008 11:88478536-88478558 TGGCAGTCATTGTTAAGAAAAGG + Intergenic
1086591879 11:88524525-88524547 TGGGATTTGGTTTTAAGAAAAGG - Intronic
1087283062 11:96233817-96233839 TGGTATTCAGTGTTAGAAAAAGG + Intronic
1088062384 11:105671024-105671046 TGTGACTCAGTGTGGAAAAAGGG - Intronic
1089334877 11:117716345-117716367 TGGGAATCAGTGGTCAGAAAGGG - Intronic
1090928813 11:131277355-131277377 TGGGCTTCAGAGAGAAGAAAAGG + Intergenic
1091256630 11:134193449-134193471 TGAGATTTAAAGTGAAGAAAAGG + Intronic
1092607768 12:10138613-10138635 TGGGGTTCAGTGAGATAAAATGG + Intergenic
1095302829 12:40606767-40606789 TGGGACTCAGTGTGGAAATATGG + Intergenic
1095508237 12:42921275-42921297 TGAGATGCTGTGTGAAGAGAAGG + Intergenic
1096096742 12:48940466-48940488 TGAGAGGCAGAGTGAAGAAAGGG + Intronic
1096481132 12:51941764-51941786 TGGCACTCGGTGTGAAGAAGGGG + Intergenic
1101029396 12:100644874-100644896 TGGGATTCACTATTCAGAAAGGG - Intergenic
1101477257 12:105062673-105062695 TGGAATTCAGTGGGGAGATAAGG - Intronic
1102497705 12:113330811-113330833 TGGGATTCCTGCTGAAGAAATGG + Intronic
1102910405 12:116709247-116709269 AGGGCTGCAGTGAGAAGAAAGGG + Intergenic
1102941846 12:116949602-116949624 TGCGATTCTGCGTGAGGAAAAGG - Exonic
1103971275 12:124674311-124674333 GGGGCTTCAGGGTGAAGCAAAGG - Intergenic
1106715381 13:32383056-32383078 TGAGAGTCAGAATGAAGAAAAGG + Intronic
1107319056 13:39166472-39166494 TGGGACCCAGAGTGAAGGAAAGG + Intergenic
1108026693 13:46185386-46185408 TGGGCTGCAGAGTGAAGCAAAGG - Intronic
1108269154 13:48741421-48741443 TAGGATTGAGTTTGAAGAAAGGG + Intergenic
1109376697 13:61504482-61504504 TGTCATGCAGTGTTAAGAAACGG + Intergenic
1109503929 13:63274016-63274038 TGGGAGACTGTGTGAAGGAAAGG + Intergenic
1111507903 13:89219244-89219266 TAGGATTCTATGTGAAGAATAGG + Intergenic
1112124668 13:96451794-96451816 TGGGATTAAATGTACAGAAAAGG + Intronic
1112693271 13:101918404-101918426 GGAAATTCAGTGTGAAGCAAGGG + Intronic
1112806287 13:103167004-103167026 TGGGGTTCAGTGGGAGGAATGGG + Intergenic
1113257700 13:108524748-108524770 TGGGATTGTGTGTGATGACAGGG + Intergenic
1114478575 14:23015954-23015976 TGAGATTCAGAGTTGAGAAAGGG + Intergenic
1114818445 14:25987355-25987377 TGTAATTTAGTGTGGAGAAATGG - Intergenic
1115282912 14:31684933-31684955 TGTGATTTAGTGGGAGGAAAAGG + Intronic
1115322509 14:32098923-32098945 TCGGTTACAGTGTGAAGAATGGG + Intronic
1116227695 14:42172584-42172606 GGGCATTCAGTGAGAAGAAATGG - Intergenic
1116635501 14:47389720-47389742 TGGGCCTCAGGGTGAAAAAAGGG + Intronic
1119490830 14:75031510-75031532 TGGGATACAGTGGAAAGAATAGG + Intronic
1120667887 14:87328687-87328709 TGGGATTCTGTGAGAAAAAAAGG + Intergenic
1122523748 14:102364782-102364804 TGGAACTTAGTGGGAAGAAAAGG + Intronic
1123394180 15:19911985-19912007 GGGCATGAAGTGTGAAGAAAAGG - Intergenic
1123584889 15:21750079-21750101 TGGGATTCAGTGTGATAGATAGG + Intergenic
1123621534 15:22192686-22192708 TGGGATTCAGTGTGATAGATAGG + Intergenic
1125151466 15:36537217-36537239 TGTCATTCAGTGTGAGGAGATGG - Intergenic
1125229517 15:37437023-37437045 TGAGACTCAGTTTGCAGAAAAGG + Intergenic
1125429066 15:39578418-39578440 TGGCAGTAAGTGTGAGGAAAGGG - Intergenic
1125747312 15:42005636-42005658 TGGGACTCTGAGGGAAGAAAAGG + Intronic
1126914168 15:53447194-53447216 GTGGATTCAGGGTGAAGCAAAGG + Intergenic
1127525500 15:59788457-59788479 TGGCATTCAGTCTGAAAAAAAGG - Intergenic
1131509625 15:93042585-93042607 TGGCATTTAGTTTGAAGAGAAGG + Intronic
1131647343 15:94359611-94359633 TGGGATTCCATTTGCAGAAAGGG + Intronic
1132911114 16:2312420-2312442 TAGTATTCTGTGTGACGAAATGG - Intronic
1137500404 16:49006830-49006852 ATGGATTCAGGGTGAAGCAAGGG + Intergenic
1138239575 16:55416331-55416353 TGTGATTCAGTGTGACACAAAGG + Intronic
1138315517 16:56066450-56066472 TGTGATTCAGTGCAAAGCAAAGG - Intergenic
1141289012 16:82700286-82700308 TGGGATGCCCTGTGAACAAAAGG - Intronic
1141955202 16:87366147-87366169 TGGGATTCTGGGAGAAGAAAAGG + Intronic
1142603878 17:1071150-1071172 TGAGATTCAGTCTCAAAAAAAGG + Intronic
1142703882 17:1682062-1682084 TGGGAGGCAGTGGGTAGAAATGG - Intronic
1143302291 17:5919450-5919472 TGGGACTGAGGGTGGAGAAAAGG + Intronic
1144253323 17:13440989-13441011 TGAAATTCTGGGTGAAGAAATGG - Intergenic
1145324549 17:21792001-21792023 GGGGATGAAGTGGGAAGAAAAGG + Intergenic
1145326055 17:21826808-21826830 GGGGATGAAGTGGGAAGAAAAGG - Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1147346267 17:39797792-39797814 TAGGATGCAGAGGGAAGAAAAGG - Intronic
1147675754 17:42204180-42204202 GGGGATTCTGTGGGAAGCAAAGG - Intronic
1151102752 17:71574614-71574636 TGAGATTTAGTGTTAAGCAAGGG - Intergenic
1151587650 17:75020299-75020321 TGGAATTCACTGTGGAGGAAAGG - Exonic
1151640167 17:75386538-75386560 CTGGCTACAGTGTGAAGAAATGG - Intronic
1152201028 17:78946344-78946366 TGAGACTCAGTGTGATGACACGG - Intergenic
1152673119 17:81621009-81621031 TGAGATTCTGTCTCAAGAAAAGG + Intronic
1155128344 18:22903014-22903036 TGCCACTCAGTGGGAAGAAAGGG - Intronic
1155367389 18:25062313-25062335 TAGGCTTAAGTGTAAAGAAAAGG + Exonic
1155417635 18:25617013-25617035 CAGACTTCAGTGTGAAGAAAAGG + Intergenic
1156330515 18:36117320-36117342 GGGGTTTCAGTGTGCAGAAGAGG - Intronic
1156731391 18:40197472-40197494 AGGGATGCATTGAGAAGAAAGGG + Intergenic
1157078614 18:44496326-44496348 TTGGATGGAGTGTAAAGAAATGG + Intergenic
1157796999 18:50583794-50583816 TCTGATTCAGTGTGAAGAGAAGG - Intronic
1159703163 18:71655206-71655228 TAGGATACAGTGGGAAGAAAGGG - Intergenic
1160326655 18:77956244-77956266 TTGGATTCGTTATGAAGAAAAGG + Intergenic
1161257347 19:3316668-3316690 TGGGCTTCTGTGGGGAGAAAGGG + Intergenic
1162552518 19:11365497-11365519 TGGGGGGCAGTGTGAAGAACAGG - Exonic
1162771869 19:12954007-12954029 GGGGCTTCAGTGGGAGGAAAAGG - Exonic
1162861574 19:13509422-13509444 TGGGATTCAGGGAGAAGGAGGGG + Intronic
1164554388 19:29239774-29239796 TTGTATTCATTGTGAAAAAATGG - Intergenic
1164729910 19:30495749-30495771 TGGGATTCAGTGTCAGGCAGTGG + Intronic
1166790469 19:45395986-45396008 TGGGAGTGAGGGAGAAGAAAGGG + Intronic
1168469773 19:56630555-56630577 TGGGCTTCTGTGTGGAGAACAGG + Intergenic
925527861 2:4823329-4823351 TGGGATAAAGGGGGAAGAAAGGG + Intergenic
925919528 2:8629384-8629406 TGGTATTTAGTGTGAAAAAGAGG - Intergenic
926102926 2:10132078-10132100 TGGGATTCCGAGTCAGGAAAGGG - Intergenic
928682580 2:33717516-33717538 TGGGCTACAATGTGAAGATAGGG + Intergenic
929180647 2:39034809-39034831 AGGGACTCAGTGTGAGGATAAGG - Intronic
930033449 2:47071840-47071862 TGGGATTCTGTTTGAAAAATGGG - Intronic
930052329 2:47226001-47226023 TGGAACAGAGTGTGAAGAAAGGG - Intergenic
930374776 2:50551274-50551296 TGGGAGTGAGTGTGGAGAGAAGG - Intronic
931219712 2:60278042-60278064 TAGGATTCAGGGAGAAGAGAAGG - Intergenic
931947840 2:67331323-67331345 AGGGATTAAGAGTGTAGAAAGGG + Intergenic
933408740 2:81897462-81897484 TAGGATTCAGTGTGAAAGTACGG - Intergenic
933810309 2:86028963-86028985 TTAGATTCAATGGGAAGAAAAGG + Intronic
933917131 2:87006894-87006916 TGGGATACAGTGCCAAGGAAGGG + Intronic
934005865 2:87763020-87763042 TGGGATACAGTGCCAAGGAAGGG - Intronic
935428904 2:102951582-102951604 TGGGGTCCTGTGTGAAGATAAGG + Intergenic
935556285 2:104513140-104513162 TGGGATTCAGAGTGCTGACAAGG + Intergenic
935655224 2:105417063-105417085 TAGTATTCAGAGTGATGAAAGGG - Intronic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935768817 2:106397120-106397142 TGGGATACAGTGCCAAGGAAGGG - Intronic
937492581 2:122385551-122385573 TGTCATTCTGTGTGCAGAAATGG + Intergenic
938098547 2:128479544-128479566 GGGGAATCAGAGTGAAGGAAAGG + Intergenic
939598239 2:144154724-144154746 TATACTTCAGTGTGAAGAAACGG - Intronic
940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG + Intronic
941147914 2:161875879-161875901 AGGGATTCTCTGGGAAGAAATGG - Intronic
941250011 2:163149603-163149625 TGTGATTCTGTGGAAAGAAATGG - Intergenic
943151191 2:184115693-184115715 TGGCTTTCACTGTGAGGAAATGG + Intergenic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
946065653 2:216985267-216985289 TGGTATGCAGTTGGAAGAAAAGG + Intergenic
1168758828 20:334677-334699 TGGGCTGCAGTGTGAAGACTCGG - Intergenic
1169858891 20:10131717-10131739 TGGGTATCAGTGTGAAATAATGG - Intergenic
1169972491 20:11283317-11283339 TGGGCAACAGTGTGGAGAAAAGG + Intergenic
1171915829 20:31061533-31061555 TGGAATGGAATGTGAAGAAATGG + Intergenic
1171920941 20:31098247-31098269 TGGAATGCAGTGGAAAGAAATGG + Intergenic
1171929445 20:31216407-31216429 TGGAATGCAGTGGAAAGAAATGG + Intergenic
1172959360 20:38787627-38787649 TGGGATTCAGTGTGCAGACAGGG - Intergenic
1173310077 20:41889502-41889524 TGCAAGTCAGTGTGAGGAAAGGG + Intergenic
1173318893 20:41969961-41969983 TGGGTTTCTGTCTGAGGAAAGGG + Intergenic
1173455447 20:43197741-43197763 TGAGATTCAGTCTGATAAAAAGG - Intergenic
1175745408 20:61453518-61453540 AAGGATTCAGTGTGTGGAAAAGG + Intronic
1177068775 21:16474522-16474544 TTGGATTCAGAGTGTAGAATTGG + Intergenic
1178104912 21:29307201-29307223 GGGGAATGAGTGTGTAGAAAAGG - Intronic
1178272437 21:31203813-31203835 AGCGAGTCAGTGTGAAGACAAGG + Intronic
1178622810 21:34191352-34191374 TGGGATTCAGTTTGGCCAAAGGG + Intergenic
1180115511 21:45701247-45701269 TCTGACTCAGTGTGAGGAAAGGG + Intronic
1181394022 22:22605120-22605142 TGGGATTCAGGTTGAAGACAAGG + Intergenic
1182056112 22:27355965-27355987 TGGAGATCACTGTGAAGAAATGG + Intergenic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
1203309053 22_KI270736v1_random:129822-129844 TGGAATACAGTGTAATGAAATGG + Intergenic
949844459 3:8355852-8355874 GGGGATAGAGTGTGAAGAACAGG - Intergenic
951809195 3:26680651-26680673 TGATATTCTGTGTGAAGATATGG - Intronic
952061771 3:29519375-29519397 TGGGATGCAAGGTGAAGAAGAGG + Intronic
953000054 3:38924170-38924192 TGCGCTTCACTCTGAAGAAATGG - Intronic
953565104 3:44025659-44025681 TGGGATAGAATTTGAAGAAAGGG - Intergenic
956408657 3:68955399-68955421 TGGGATTTAATGTGCAAAAATGG - Intergenic
958658144 3:97030276-97030298 TGGGGTCCAGTGTGAACTAATGG - Intronic
960073418 3:113457668-113457690 TGAGACTCTGTGTGAAAAAAAGG - Intronic
962702705 3:138014673-138014695 TGGGATTGAGTTTGCAGAAAAGG + Intronic
962994773 3:140614917-140614939 TGGGAATTAGTGTGAGAAAAGGG + Intergenic
963418850 3:145033404-145033426 TGGACTTCAGTATCAAGAAATGG - Intergenic
963892170 3:150648038-150648060 TGGGCTTCAGTGGGAATATATGG - Intergenic
964967960 3:162521626-162521648 TAGGAATCAGTGAGAAGAGATGG - Intergenic
965716141 3:171605252-171605274 TGAGATTCAGTGAAAAGAAACGG + Intronic
969961388 4:10948025-10948047 TGAGGTTCTGTGAGAAGAAAAGG - Intergenic
970948870 4:21728679-21728701 TGTGATCCAGAGTGAAGAAGAGG - Intronic
971740801 4:30518131-30518153 AGAGATTGAGTGGGAAGAAAAGG + Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972601994 4:40581113-40581135 TGGGTTTTAGTCTAAAGAAAAGG + Intronic
973827895 4:54727400-54727422 TGGGTTTCTGTGGGGAGAAAGGG - Exonic
974279180 4:59768682-59768704 TTGGCTTCAGTGTGCAAAAAGGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974767638 4:66368443-66368465 TGGGAAGAAGTGTGAAGAATTGG - Intergenic
977227838 4:94414530-94414552 TGAGATGTAGTGTGAAGAACAGG + Intergenic
977878063 4:102172188-102172210 TGTTATTCAGTCTGTAGAAAAGG + Intergenic
978599879 4:110416502-110416524 TGAGTTTCAGTGGCAAGAAATGG + Intronic
979433183 4:120657078-120657100 TGGGCAACAGAGTGAAGAAAGGG + Intergenic
979735806 4:124082109-124082131 TGTGTTTTAGTGTGAATAAATGG - Intergenic
980274462 4:130631616-130631638 TGGAGTACAGTGTGAAGAGAGGG + Intergenic
980651998 4:135728582-135728604 TGGGTTTCAGAGTGCAGTAATGG + Intergenic
981153488 4:141406330-141406352 TGGCATCCAGTGGGTAGAAAAGG + Intergenic
981357970 4:143813568-143813590 TGGTATTTAGTATGAAGGAAGGG + Intergenic
981775727 4:148365107-148365129 TGGAAATAAGTGTTAAGAAAAGG - Intronic
982420057 4:155184190-155184212 TGGGGTTCAGTGTCAAGAGAGGG - Intergenic
982574726 4:157095594-157095616 TGGGAATGAGGTTGAAGAAATGG + Intronic
984269281 4:177531093-177531115 TGAGGTTCAGTGTTAAGAAAGGG - Intergenic
984658223 4:182343202-182343224 TGGAATTCACTGTGATTAAAAGG - Intronic
985092571 4:186379212-186379234 TGTGTTGCAGTCTGAAGAAAGGG - Intergenic
985872080 5:2564933-2564955 TGGCTTTCAGTGTCAAGAGAGGG + Intergenic
987638845 5:20584876-20584898 TGGTATTCAGTGTTTAAAAAGGG + Intergenic
988081527 5:26421029-26421051 TAGGAAACATTGTGAAGAAATGG - Intergenic
988486623 5:31672867-31672889 TGGGGTTCAGTGTTATGTAAAGG - Intronic
989729603 5:44633019-44633041 TGGGATTTATTCTGAGGAAAAGG - Intergenic
991357509 5:65784496-65784518 CGGCATTCAGTGTCTAGAAAGGG + Intronic
992088838 5:73300315-73300337 TGGGAACTCGTGTGAAGAAATGG + Intergenic
992771388 5:80051415-80051437 TTGGATCAAGTGTGAAGAATGGG + Intronic
992941631 5:81768127-81768149 AGTGATTCAGTGTTAAAAAATGG - Intergenic
993051485 5:82931202-82931224 TGGGTTTCATTTTGAAGAAGAGG + Intergenic
993144496 5:84076974-84076996 TAGTATTCTGTGTGATGAAAAGG - Intronic
993694372 5:91042854-91042876 TGTGATTCAGAGTGCTGAAAGGG + Intronic
994142713 5:96360054-96360076 TGAAATTAAGTGTGAAGACAAGG - Intergenic
994372730 5:98985756-98985778 TCTGATTCTGAGTGAAGAAAAGG + Intergenic
994750863 5:103735381-103735403 TGGGCTTCAGTTTTTAGAAAAGG - Intergenic
995274838 5:110266378-110266400 GAGGATTCAGTGTGAAACAAGGG - Intergenic
995473691 5:112527658-112527680 TGGGATTCACTATTCAGAAAGGG + Intergenic
995698628 5:114907474-114907496 TGGTATTCAGTATGAAAACAAGG - Intergenic
996169893 5:120276626-120276648 TGGTAAGCAGTGTGAATAAAAGG + Intergenic
996672170 5:126131024-126131046 TGGCTTTCAGAGTGAAAAAAGGG + Intergenic
997364006 5:133313883-133313905 TTTGATTCAGTGTCAAGGAAAGG + Intronic
997367952 5:133337899-133337921 TAGGATACTGTTTGAAGAAATGG + Intronic
997404828 5:133637234-133637256 TAGGTTTCAGGGAGAAGAAAGGG - Intergenic
997842104 5:137251256-137251278 TGGGATTCACTTTGAGGAATAGG - Intronic
997958943 5:138303882-138303904 TAGGACACAGTGTGAAGGAAGGG + Intronic
999650791 5:153765447-153765469 TGGGAGTCATTCTGAAGAATGGG + Intronic
999827541 5:155288537-155288559 AGGGACACAGTGTGAAGTAAGGG + Intergenic
999892722 5:155996363-155996385 CAGGATTCAGTGACAAGAAACGG + Intronic
1000491325 5:161917571-161917593 TGGTATTCTGTGTGATGAAATGG + Intergenic
1001867363 5:175117116-175117138 GGAGATGCGGTGTGAAGAAAAGG + Intergenic
1002864279 6:1107542-1107564 TGAGATTCGGGGTGAAGAACAGG - Intergenic
1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG + Intronic
1003609371 6:7595664-7595686 TGAAATGCAGTGTAAAGAAAAGG + Intronic
1004235154 6:13868540-13868562 TGGGAGTGAGTGTGAGGAATGGG + Intergenic
1004487576 6:16081860-16081882 TGGGATCAAATGTGAAGAGAGGG + Intergenic
1005391387 6:25337288-25337310 TGTTATTCAGTGTGAATATATGG - Intronic
1005493173 6:26365607-26365629 TGGGATTTAGTGGAAGGAAAGGG + Intronic
1006825007 6:36928431-36928453 GGGGTTGCAGTGTGAAGAATGGG - Intronic
1007908353 6:45487418-45487440 TGGGAATCAGAGAGATGAAAGGG - Intronic
1008609043 6:53169060-53169082 GGGAATTCAGTTTGAAGAATTGG - Intergenic
1009503741 6:64449276-64449298 TGAAATGAAGTGTGAAGAAAAGG + Intronic
1010291556 6:74143424-74143446 TGGGAGTCAGGGAGAAGCAAAGG + Intergenic
1012602583 6:101116096-101116118 TGGGAGCCAGTGTGAAGAGCAGG + Intergenic
1012687687 6:102273045-102273067 TTGGATTCAATGTCAAGAAGAGG + Intergenic
1013569137 6:111402844-111402866 AGGAATTCAATGAGAAGAAAAGG + Intronic
1015090342 6:129348707-129348729 TGTGATTCAGTGTGAGGAAAGGG - Intronic
1015469697 6:133590186-133590208 TAGGATTGAGAGTAAAGAAAGGG + Intergenic
1015642185 6:135346888-135346910 TGGGGTTTGGTGGGAAGAAAGGG - Intronic
1016569691 6:145498041-145498063 TGGGATCCTGTTTAAAGAAATGG + Intergenic
1016930679 6:149404733-149404755 TTGTATACAGTGTGAAGTAATGG - Intronic
1016936652 6:149452880-149452902 TGGGGTTCAGTGTGAAGGGAAGG - Intronic
1017799827 6:157884575-157884597 TGGGAGTGAGAGTGAAGAGATGG - Intronic
1018722611 6:166584355-166584377 TGTGATTCTATGTGGAGAAAGGG - Intronic
1019953603 7:4393406-4393428 TGCCTTTCAGTGGGAAGAAAAGG + Intergenic
1020861679 7:13501031-13501053 TTGGAATCAGGATGAAGAAAAGG + Intergenic
1021217002 7:17928516-17928538 TGAGAGTCAGTGTAAAGTAATGG - Intronic
1021423273 7:20469498-20469520 TGAGATTCAGTGAAAAGAGAAGG - Intergenic
1021800258 7:24298310-24298332 TGTTATTTAGTGAGAAGAAAGGG - Intergenic
1022385850 7:29898445-29898467 TGGGCTGCAGTGTGAAGCAGTGG - Intronic
1022736914 7:33084649-33084671 TGGTATTCAGTGTAAAAAAATGG + Intergenic
1024197276 7:47071542-47071564 TGGCATTCACTGAGAATAAAAGG + Intergenic
1026351554 7:69519873-69519895 TGGCACACAGTGTGAAGAAGGGG + Intergenic
1027143868 7:75680436-75680458 GAGGCTTCAGTGTGAAGAATGGG - Intronic
1027527004 7:79282028-79282050 TAGAAATCTGTGTGAAGAAAAGG + Intronic
1028213965 7:88109153-88109175 TGGGATTCAGGCTGAAAAAAAGG - Intronic
1028338685 7:89691147-89691169 TGGGATTCACTGTAAAGTAGAGG + Intergenic
1028618462 7:92797611-92797633 TATGCTACAGTGTGAAGAAAAGG - Intronic
1028817541 7:95164496-95164518 TGGGATTCAATCTGAAGACTTGG + Intronic
1029130214 7:98324210-98324232 TGTGATTCAGTCTGAATAAGTGG + Intronic
1030628154 7:111866567-111866589 TGGGAGTCAGTGTGTTGAAGAGG + Intronic
1031439121 7:121771596-121771618 TGTGATTCAGTTTGCAAAAATGG - Intergenic
1033537347 7:142324067-142324089 TGGGAATCAGTGTCAGGACAGGG + Intergenic
1036398518 8:8387657-8387679 TTGGCTTCTGTGTGAGGAAAGGG + Intergenic
1038922053 8:32095286-32095308 TGGGATTGAGAGTGAAGACTGGG + Intronic
1039283811 8:36016958-36016980 TGGGCTTATGTGTGAAAAAAGGG + Intergenic
1040595827 8:48836606-48836628 TTGGATTCAAAGTGGAGAAAGGG + Intergenic
1041185798 8:55299682-55299704 TGGTATACAGAGTGAAGAACAGG + Intronic
1042295093 8:67209821-67209843 TGGGGTGCAGTGTGGAGAAAAGG + Intronic
1042839737 8:73111601-73111623 TGGGCTTCAGTGGAAAAAAATGG - Intronic
1043921854 8:85992024-85992046 AGGGGTTAAGTGTGGAGAAAGGG + Intronic
1043924317 8:86020076-86020098 TGGGATACAGTTGGAAGAACTGG + Intronic
1044503955 8:92994671-92994693 TTGGATTGAGTGTCAAGAATTGG - Intronic
1044739349 8:95309924-95309946 TGGAAGGCAGTGTTAAGAAAGGG + Intergenic
1045084277 8:98664156-98664178 TGGGAATCAGTAGAAAGAAATGG - Intronic
1047105992 8:121730844-121730866 TGAGATTGAGGGTGAAGAGAGGG + Intergenic
1049266951 8:141672692-141672714 TGGAATTCAGTTTGATGACAGGG - Intergenic
1049721923 8:144121030-144121052 TGCGATTCAGGGGGAAGATATGG + Intergenic
1049782228 8:144434317-144434339 TGGGATTCAGAGGGCAGAAAGGG - Intronic
1050261424 9:3844892-3844914 TAACATTCAGTGTGAGGAAATGG + Intronic
1051997148 9:23231603-23231625 TGGTATTCAGTATGCAGAAGAGG - Intergenic
1052139829 9:24966933-24966955 TTGGTGTCAATGTGAAGAAAAGG + Intergenic
1052818972 9:33123994-33124016 TGGGATGCAGTGAGACGGAAGGG + Intronic
1053040677 9:34868203-34868225 TGGAATTCAGTTTGAAGATTTGG + Intergenic
1053108775 9:35438609-35438631 TTGGATTTAGTATGAACAAATGG + Intergenic
1055320174 9:75075933-75075955 TGTGATTCCATGTGGAGAAAGGG + Intronic
1055792427 9:79937116-79937138 TGGCAGTGAGTGTGGAGAAAGGG + Intergenic
1056681906 9:88726477-88726499 AGGGATATAGTATGAAGAAAGGG + Intergenic
1057529255 9:95829934-95829956 TGGGTTTGAATGTGAAGGAATGG + Intergenic
1059958521 9:119543009-119543031 TGGGGTGCAGTGGAAAGAAATGG - Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1060718935 9:125961031-125961053 TGGCATTCACTGTGAAGAGTGGG - Intronic
1061794464 9:133077446-133077468 TGGGAGTCAGTTTGCAGGAAGGG + Intronic
1203389654 Un_KI270438v1:85981-86003 TGGAATTCAGTGGAAAGGAACGG + Intergenic
1203347745 Un_KI270442v1:47182-47204 TGGAATTCAGTGGAATGAAATGG + Intergenic
1185909817 X:3971181-3971203 TGGGATTCACTATTCAGAAAGGG + Intergenic
1188546978 X:31318572-31318594 TGAGATTGAGAGTGAAGAGAAGG + Intronic
1190425987 X:50334941-50334963 TGGGATTCACTATTCAGAAAGGG - Intronic
1190458124 X:50644728-50644750 TGAGATACAGAGGGAAGAAAGGG - Intronic
1190726326 X:53193014-53193036 GGGGAGTCAGAGTGGAGAAAGGG + Exonic
1191036167 X:56028428-56028450 TGGGATTCACTATTCAGAAAGGG - Intergenic
1194508067 X:94758078-94758100 TGGGACTCAGTGTAAAAAAATGG - Intergenic
1196054255 X:111338249-111338271 TGGAATTCAGGGTGAAGAGGAGG + Intronic
1196692129 X:118571243-118571265 TGGGGTACAGTGAGTAGAAATGG - Intronic
1196970917 X:121107652-121107674 TGGGATGCAGTATGCAGGAATGG + Intergenic
1198169344 X:134090511-134090533 TGGCAGTCAGTGTGGGGAAAGGG - Intergenic
1198432523 X:136581631-136581653 TGGGATTCAAGGTTAAGATAGGG - Intergenic
1198894236 X:141433529-141433551 TAATATTCTGTGTGAAGAAATGG - Intergenic
1200394221 X:155973908-155973930 TGGGATTTACTGTTCAGAAAGGG - Intergenic
1201098327 Y:10652196-10652218 TGGAATTCAGTGGAAAGGAATGG - Intergenic
1201270230 Y:12247008-12247030 TGGGATTCACTATTCAGAAAGGG + Intergenic
1201554972 Y:15258033-15258055 TGAGATTCACTGTTCAGAAAGGG + Intergenic
1201596508 Y:15676049-15676071 TTGTATACAGTGTGAGGAAAGGG - Intergenic
1201680637 Y:16641056-16641078 TGGGATTCACTGTTCAGAAAGGG - Intergenic
1201983927 Y:19940740-19940762 TTGGTGACAGTGTGAAGAAATGG + Intergenic