ID: 1003346266

View in Genome Browser
Species Human (GRCh38)
Location 6:5270738-5270760
Sequence GGTAAGCGCCATAGTCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003346266 Original CRISPR GGTAAGCGCCATAGTCGTCA GGG (reversed) Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
1088819418 11:113444758-113444780 GGCAAGCTCCATTGTCCTCACGG + Intronic
1094441875 12:30486678-30486700 GGAAAGTGCCATAGTCATAATGG + Intergenic
1106915058 13:34504655-34504677 GGTAAGTGACATAGTCTTAAAGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1127411652 15:58713720-58713742 AGTCAGTGCCATAGTCGTTAAGG - Intronic
1143408558 17:6694807-6694829 GGTCAGCACCAAAGTCTTCATGG - Intronic
1159707308 18:71707528-71707550 TGTAATCCCCATAGTCCTCAAGG + Intergenic
930166302 2:48206814-48206836 GCTAAGTGCCATAGTGGTCTTGG - Intergenic
993068913 5:83134025-83134047 GGCAAGCGCCGCAGTCTTCACGG + Intronic
999808362 5:155105018-155105040 GGTACCTGCCATAGACGTCAGGG + Intergenic
1003346266 6:5270738-5270760 GGTAAGCGCCATAGTCGTCAGGG - Intronic
1015922210 6:138277828-138277850 GGTAAGCGGCATATTGGTGAGGG + Intronic
1018753891 6:166831361-166831383 GAGAAGCTCCATAGTCATCATGG - Intronic
1200084358 X:153596089-153596111 GGTAAGGGTCATAGGCGTCCAGG + Exonic