ID: 1003347068

View in Genome Browser
Species Human (GRCh38)
Location 6:5279829-5279851
Sequence TTGGATGAGGACCACCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 10, 3: 24, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003347064_1003347068 5 Left 1003347064 6:5279801-5279823 CCATTTTTCTATTCAGGACCTCA 0: 1
1: 0
2: 8
3: 42
4: 702
Right 1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG 0: 1
1: 0
2: 10
3: 24
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003347068 Original CRISPR TTGGATGAGGACCACCACAT TGG Intronic
901127572 1:6940414-6940436 TTGGATGATGCCCCCCACACTGG + Intronic
907022964 1:51086787-51086809 TGGGATGTGCAGCACCACATTGG + Intergenic
907277697 1:53326377-53326399 CTGGGCGAGGACCACCCCATAGG - Intronic
907611567 1:55876230-55876252 TTAGATGAGGTCCATCACATTGG - Intergenic
908698148 1:66868470-66868492 TTGGATGATGCCCACCACATTGG - Intronic
913159780 1:116134338-116134360 GTGGATGAGGACCTCCCCCTGGG + Exonic
915590135 1:156866154-156866176 TGGGAGAAGTACCACCACATAGG - Intronic
915664995 1:157436415-157436437 TTGGGTGAGGACCTAAACATAGG + Intergenic
916677170 1:167073710-167073732 TGCGATGAGGACAAACACATGGG + Intronic
920527297 1:206676615-206676637 GTGGAGGAGGAAAACCACATAGG + Intronic
921518280 1:216125484-216125506 ATGAAGGAGGACCACTACATTGG + Intronic
923888695 1:238187079-238187101 TTGGATGAGGCCCACCACTTTGG + Intergenic
924431448 1:244000694-244000716 TTGGAGGAGGAAGACCACAGAGG - Intergenic
1063437889 10:6049321-6049343 TTGGATGATCCCCACCACACTGG + Intronic
1064508960 10:16067994-16068016 TTTGATGAGGACCACCCAATTGG - Intergenic
1065923779 10:30417562-30417584 TTGGATGGGGACCAGCATCTGGG + Intergenic
1068543875 10:58325819-58325841 TTAGATTAGAACCACCACTTGGG - Intergenic
1069286148 10:66717674-66717696 CTGGATGAGTACCATCTCATGGG - Intronic
1075245871 10:120821813-120821835 TTGGATGCAGACAAGCACATGGG + Intergenic
1076209549 10:128629454-128629476 CTGGATGAAGACCAGGACATGGG - Intergenic
1076591213 10:131584826-131584848 TTGGATGAGGCCACCCATATTGG - Intergenic
1079142684 11:17823232-17823254 TTGGAGGAGGAAGACCACAGAGG + Intronic
1079756494 11:24271099-24271121 TTGGATGGTGCCCACCACGTAGG + Intergenic
1080907533 11:36561588-36561610 TTGCATGATGCCCACCTCATAGG - Intronic
1084297430 11:68222010-68222032 TTGGATGAGGCCCCCCACACTGG - Intergenic
1087398887 11:97638579-97638601 TTAGATAATGACCACCACACTGG + Intergenic
1087615550 11:100482656-100482678 TTGGATTAGGTCCACCATAATGG + Intergenic
1088092765 11:106062635-106062657 TTGGATAAGGCCCACCACACAGG + Intronic
1091231362 11:133989935-133989957 TTGGGTGAGGCCCACCACACTGG - Intergenic
1092027917 12:5258512-5258534 TTGGATGAGGATGCCTACATTGG - Intergenic
1092140477 12:6180205-6180227 GGGGATGAGGACCTCAACATAGG + Intergenic
1095417216 12:41990078-41990100 TTGGCTCAGGACCTCCACAGAGG - Intergenic
1096540624 12:52304972-52304994 CTGGATCAGGGCCTCCACATTGG - Exonic
1106221957 13:27753664-27753686 TTGGATGATGCCCACCACATTGG + Intergenic
1108949139 13:56065678-56065700 TTGGAAGAGGACCAGTACAAAGG - Intergenic
1109294615 13:60514390-60514412 TTGGATGAGCACCATGACCTTGG + Intronic
1117369398 14:55062887-55062909 CTGGATAAGGACCACCAGGTGGG - Exonic
1118397538 14:65350225-65350247 TGGGATGAGTTCCAGCACATGGG - Intergenic
1121679182 14:95778493-95778515 TTGGATGAGGCCCACCATATTGG + Intergenic
1124615980 15:31242491-31242513 TAGGATGGGGACCACCACCTTGG + Intergenic
1124854702 15:33376538-33376560 TTGGATGAGGGCTACCCCCTGGG + Intronic
1130145044 15:81267664-81267686 TTGGATGGGAACCACACCATTGG - Intronic
1130851855 15:87802607-87802629 TTGGATGATGCCCACCCCACTGG - Intergenic
1131949483 15:97665681-97665703 TTGGATGATGCCCACCATATTGG - Intergenic
1133104523 16:3498255-3498277 TTGGATGATGCCCACCACACTGG + Intergenic
1135148724 16:19986657-19986679 TTGGATGATGCCCACCATATTGG + Intergenic
1135569165 16:23535127-23535149 GTGGTGGACGACCACCACATGGG - Exonic
1136082953 16:27864858-27864880 TTGGAGGTGGACCCACACATGGG - Intronic
1137652065 16:50129124-50129146 CTGGATGAGGACCCCCACACTGG + Intergenic
1138643245 16:58403222-58403244 TTTGTGGAGGTCCACCACATTGG - Exonic
1144369927 17:14580392-14580414 TGGGATGAGGAATACCACAGAGG + Intergenic
1148834257 17:50457338-50457360 TAGGCTGAGGACCACACCATTGG + Intronic
1149219293 17:54397607-54397629 TTGGATGAGGCCACCCATATTGG - Intergenic
1152348309 17:79768464-79768486 TTGGGTTAGGGCCACCACAATGG - Intergenic
1153854877 18:9136364-9136386 GGCGATGAGGACCCCCACATAGG - Intronic
1162179350 19:8856832-8856854 ATGGATGTGCACCACCACACCGG - Intronic
1165920556 19:39295194-39295216 TTGGATGGTGCCCACCACATTGG + Intergenic
1166374022 19:42316932-42316954 GTAGATGAGCAGCACCACATGGG - Exonic
1166785486 19:45364423-45364445 TTCGACGAGGCCCACAACATTGG - Exonic
1168305318 19:55432130-55432152 CTGGAGGAGGCCCTCCACATGGG + Exonic
925165306 2:1711902-1711924 TTGGATGAGGAGGACCTCCTGGG - Intronic
926151941 2:10430136-10430158 GTGGATGAGGACCCCCACATTGG + Intergenic
927511186 2:23644735-23644757 TTGGCTCAGGACCACCACAGAGG - Intronic
928269801 2:29845806-29845828 TTGGTTGAGGAGCACCTCTTGGG + Intronic
931467553 2:62505199-62505221 TTGAATGATGAAAACCACATGGG + Intronic
932187776 2:69713696-69713718 ATGGATGAGGAACCCCACAAAGG - Intronic
933254750 2:80068260-80068282 TTGGAAGAGGACCAGCAGAATGG + Intronic
934681088 2:96284371-96284393 GTGGATGAGGTCCACCTTATCGG - Exonic
935800370 2:106689681-106689703 TTGGAAGAGGCCGTCCACATGGG - Intergenic
941859530 2:170264340-170264362 TTGGATGATGACTGCCACATAGG - Intronic
943539334 2:189192425-189192447 TTACATGAGGACGACCCCATAGG + Intergenic
944339412 2:198578523-198578545 TTGGATGGGGCCCCTCACATTGG - Intergenic
947123396 2:226841055-226841077 TAGGATGAGGGCGACTACATGGG - Intronic
949051699 2:241901122-241901144 TTGGATGACGCCCAGCACACGGG + Intronic
1175750061 20:61490037-61490059 CTGGTTGATGACCATCACATTGG + Intronic
1175963637 20:62649320-62649342 TTGGACGAGGCCCACCACCCTGG + Intronic
1179676827 21:42988846-42988868 CTGGATGAGGACCCCCTCACTGG + Intronic
1179676858 21:42988955-42988977 CTGGATGAGGACCCCCTCACTGG + Intronic
1179676873 21:42989010-42989032 CTGGATGAGGACCCCCTCACTGG + Intronic
1179962628 21:44778329-44778351 TGGGATGAGGCACAGCACATGGG - Intronic
1180011232 21:45052864-45052886 CTGGATGTGGCCCACCACAACGG + Intergenic
1183917069 22:41129379-41129401 GTCTATGAGGATCACCACATGGG - Intronic
1184570454 22:45320575-45320597 ACAGATGAGCACCACCACATTGG + Intronic
949360250 3:3224087-3224109 TTGGATGAGGCTGCCCACATAGG - Intergenic
951219066 3:20050676-20050698 TTGGATGTGGACAACCTCATGGG + Intronic
951564768 3:24002423-24002445 TTGGATGATGCCCACCTCAGTGG + Intergenic
953467175 3:43132472-43132494 GTGGCTGAGGACTACTACATTGG - Intergenic
954602917 3:51884991-51885013 TTGGATACTGGCCACCACATTGG + Intergenic
956331540 3:68115747-68115769 TAGGATGGGGAGCAGCACATGGG - Intronic
956844280 3:73168172-73168194 TGAGATGAGGACACCCACATTGG + Intergenic
958482037 3:94654732-94654754 TTGGATGATGCCCAGCACACTGG - Intergenic
960906879 3:122610534-122610556 TTGGAGGAGGACCACTATCTCGG + Exonic
961357826 3:126350054-126350076 TTGGAGGGGGACCACCCCAAAGG + Intronic
966194312 3:177298131-177298153 CTGTATGAGGACCACCTCCTGGG - Intergenic
967266853 3:187698951-187698973 GTGGAAGAGGATGACCACATGGG + Exonic
967545091 3:190716226-190716248 GTGGATGTGGACCTCAACATAGG + Intergenic
969596067 4:8149920-8149942 TTGGATGGGGGCCACCACTCTGG - Intronic
972063723 4:34912163-34912185 TTGGAGGAGGAGCACCAGACTGG + Intergenic
973699175 4:53519945-53519967 TAGGGTGAGCACCAGCACATCGG - Intronic
974225521 4:59038350-59038372 TTGGATTAGGACTCACACATAGG - Intergenic
974786049 4:66620585-66620607 TTACATGAGGCCCACCACATTGG - Intergenic
975475238 4:74815601-74815623 TTGGAGGAGGCTCACCACACTGG - Intergenic
977659717 4:99569188-99569210 TTGGAGGAGGAATACCACAGAGG - Intronic
979210842 4:118100159-118100181 TTGGATGATGCCCCCTACATTGG - Intronic
981279301 4:142939056-142939078 TTGGATGATGCCCACTGCATTGG - Intergenic
983115571 4:163811970-163811992 TTAGATGATGTCCACCACATTGG - Intronic
983695357 4:170521911-170521933 TTGGATGATGCCAACCACATTGG - Intergenic
984871033 4:184325272-184325294 TTAGATGGGGCCCACCACATGGG - Intergenic
985906966 5:2846261-2846283 TAGGATGAGGCCACCCACATTGG + Intergenic
986158637 5:5202212-5202234 TTGGAGGAGGAACACCAAAAAGG - Intronic
986666641 5:10110196-10110218 TTGGATGAGGGCCACCCTAATGG - Intergenic
986963208 5:13240263-13240285 TTGGATGAGGTAAACCACAAGGG - Intergenic
989592783 5:43127375-43127397 TGGTCTGAGGACCACTACATGGG + Intronic
990698692 5:58451906-58451928 TTGTATGAGGATGCCCACATAGG - Intergenic
999436658 5:151568515-151568537 CAGGATGTGGACCACCACACGGG + Exonic
999441248 5:151602448-151602470 TTGGATCAGGACCAGCACTATGG - Intergenic
999528105 5:152430587-152430609 TTGGATGGAGACCACAGCATTGG + Intronic
1001663433 5:173413355-173413377 TTGGCTGAGGGCCACCCCAGAGG + Intergenic
1003347068 6:5279829-5279851 TTGGATGAGGACCACCACATTGG + Intronic
1003356988 6:5382966-5382988 TTGGCTGAGGCCCACCACACTGG + Intronic
1005980494 6:30832755-30832777 TTAGATGATGCCCACCACACTGG - Intergenic
1007039055 6:38704507-38704529 CTGGATTAGGACCACCTGATTGG + Intergenic
1008678927 6:53851516-53851538 TTGGATGATGCCCACTACATTGG + Intronic
1011733399 6:90289698-90289720 TTGAATGCGGACCAACACAAAGG - Intronic
1012020945 6:93918331-93918353 TTGGATGAAGCCCACTCCATTGG - Intergenic
1012471600 6:99578664-99578686 TTGGATGATGCCCACCACATTGG + Intergenic
1012582843 6:100889890-100889912 CTGGATAAGGACCACCAGGTGGG - Intergenic
1012741565 6:103022057-103022079 TTGTATGAGGCCCACCAATTAGG - Intergenic
1013244704 6:108275382-108275404 TTGCAGGAGGACCATCACAAAGG - Intergenic
1014385419 6:120795094-120795116 TTGGATGATGCCACCCACATTGG + Intergenic
1015763681 6:136692500-136692522 TTGGATGAAGGGCACCGCATAGG - Intronic
1018505377 6:164462146-164462168 TTGGATGATGCCCACCATATTGG + Intergenic
1019067729 6:169316470-169316492 ATGGAGGAGGAACACCAAATGGG - Intergenic
1022547699 7:31203950-31203972 TTTGCATAGGACCACCACATTGG - Intergenic
1025625289 7:63215984-63216006 TTGCATGAGTAACACCACAATGG - Intergenic
1028257767 7:88621610-88621632 TGGGATGAGGCCCACTACATTGG + Intergenic
1028915480 7:96254223-96254245 TTGGATGTTGCCTACCACATTGG - Intronic
1029345377 7:99974847-99974869 TTGGATGAAGCCCACCACTATGG - Intronic
1029919055 7:104242938-104242960 ATGGATGAGGACCGCCAAGTAGG + Intergenic
1030627318 7:111858471-111858493 GTGGATGAGGCTCACCACATTGG - Intronic
1031588790 7:123565251-123565273 TTGGATGATGGCCACCTTATTGG + Intergenic
1031616138 7:123882585-123882607 TTGGATGAGGCCCACCACACTGG - Intergenic
1032285483 7:130535935-130535957 CAGGATGATGACCACCAAATGGG + Intronic
1033490592 7:141839376-141839398 TTTGATGAGGACGCCCACACAGG + Exonic
1034971260 7:155420730-155420752 TTGGATGAGGCCCACCACACTGG - Intergenic
1035554648 8:557412-557434 TTGGGTGATGACATCCACATTGG - Intergenic
1041324346 8:56649093-56649115 TTGGGTGATGCCCGCCACATTGG - Intergenic
1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG + Exonic
1042693647 8:71531667-71531689 TTGGATCAGGACAACCACTAAGG + Intronic
1043325708 8:79048430-79048452 TTGGAAGAGGAAGACCACAGAGG - Intergenic
1043613444 8:82094072-82094094 TTGGATAAGGCCCACCACAATGG + Intergenic
1044576213 8:93772164-93772186 TTGTTTGAGAACCACCACTTTGG + Intronic
1046963875 8:120141205-120141227 TAGGATGAGCAATACCACATTGG - Intronic
1047274318 8:123394231-123394253 TGGGATGATACCCACCACATTGG - Intronic
1050344701 9:4674904-4674926 TGGGATGTGGACCCACACATGGG + Intergenic
1050961425 9:11738249-11738271 TTGGATGATGCCCCTCACATTGG + Intergenic
1052401428 9:28005197-28005219 TTGGCTGAGGACCACTGGATTGG - Intronic
1053422561 9:37988767-37988789 TTGGATGAGGCCCACCAACAAGG - Intronic
1057281021 9:93711580-93711602 TTGGGTGAGACCCACCACACTGG - Intergenic
1059461995 9:114437578-114437600 TTGGATTAGGACCCCACCATTGG - Intronic
1060845460 9:126833368-126833390 GTGGAGGAGGACTTCCACATCGG + Exonic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1188612870 X:32120809-32120831 TTGGATGATAACAACCACCTTGG + Intronic
1189567820 X:42261553-42261575 TTGGCTTATGTCCACCACATGGG + Intergenic
1191938398 X:66451029-66451051 TTGGATGAAGCCCACCACATTGG + Intergenic
1192162166 X:68796606-68796628 TGGGCTGAGGAACTCCACATTGG + Intergenic
1194362939 X:92976985-92977007 TTGGATGATGCCCAAAACATTGG - Intergenic
1194545729 X:95231224-95231246 CTGGATGAGGCCCAATACATGGG + Intergenic
1195373071 X:104199244-104199266 CTGGATGAGCAGCATCACATAGG - Intergenic
1197642058 X:128977809-128977831 TTGGATGTGGTCACCCACATTGG - Intergenic
1200039429 X:153354992-153355014 TCGGGTGAGGACCACCCCTTTGG - Intronic
1200671182 Y:6093214-6093236 TTGGATGATGCCCAAAACATTGG - Intergenic