ID: 1003354026

View in Genome Browser
Species Human (GRCh38)
Location 6:5348411-5348433
Sequence GGGAAATGGCCAGTAAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003354026 Original CRISPR GGGAAATGGCCAGTAAGCCA GGG (reversed) Intronic
903861120 1:26365018-26365040 GGGACAGGGGCAGAAAGCCAAGG + Exonic
904921910 1:34014522-34014544 GGGAATTCCCCAGTAGGCCATGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906529708 1:46516600-46516622 GGAAAACTGCAAGTAAGCCAGGG + Intergenic
907604832 1:55806044-55806066 GTGAAATAGGCAGGAAGCCATGG + Intergenic
908083647 1:60607624-60607646 GGGAAATGTGCAGGAAGGCAGGG - Intergenic
910302033 1:85716925-85716947 GGGAGTTGGCCAGGAAGACAGGG + Intergenic
912526185 1:110284862-110284884 GGGAAAGGGGCAGTGGGCCAGGG + Intergenic
913611383 1:120512765-120512787 AGGAAAAGCCAAGTAAGCCAAGG + Intergenic
913983407 1:143544057-143544079 AGGAAAAGCCAAGTAAGCCAAGG - Intergenic
914579809 1:149009474-149009496 AGGAAAAGCCAAGTAAGCCAAGG - Intronic
914915868 1:151818866-151818888 GGGGAATGGCGGGCAAGCCATGG - Intronic
918354781 1:183697196-183697218 AAGAAATGAGCAGTAAGCCATGG - Intronic
918872129 1:189988728-189988750 GGGAAATGGACAGTAAAACGTGG - Intergenic
919311578 1:195916724-195916746 GGGATATGGACAGTAAGGCCAGG + Intergenic
920245284 1:204583125-204583147 GGTAAATGGGCAGAAAGGCAGGG + Intergenic
920368600 1:205462520-205462542 GAGGAATGGCCAGTGAGGCAGGG - Intergenic
920563091 1:206953036-206953058 TGGAAATGGAAAGTCAGCCATGG + Intergenic
920966310 1:210704258-210704280 CTGAAATGGCCAGGAAGTCAAGG - Intronic
922509638 1:226153286-226153308 GGGAAGGGGGCAGTAAACCAAGG + Intronic
922698015 1:227741372-227741394 GGGTAGTGGCCAGGGAGCCAGGG + Intronic
1063313688 10:4981851-4981873 GGGATGTGGCCTGAAAGCCATGG + Exonic
1064485358 10:15783006-15783028 CGGATATGGCCAGGAAGACAAGG - Intronic
1065998097 10:31078666-31078688 GGGAAATGACCAGCAAGATATGG + Intergenic
1066648939 10:37637720-37637742 GGGAAGCGACCAGTAAGGCAGGG + Intergenic
1067031835 10:42883427-42883449 GGGAAGCGACCAGTAAGGCAGGG + Intergenic
1067289341 10:44929940-44929962 GGGACATGGTCAGTTAGACACGG - Intronic
1068171702 10:53403373-53403395 GGGACATGGCCTGAAAGCCGTGG + Intergenic
1070165473 10:73894359-73894381 GGGAATTCCCCAGTAAGCTAAGG - Intergenic
1071673877 10:87637108-87637130 GGGAAATCCCCATGAAGCCATGG + Intergenic
1073098423 10:100994692-100994714 GAGGAATGGCCAGTCAGGCAGGG - Intergenic
1074424927 10:113342390-113342412 CAGAAATGGCCTGTAATCCATGG + Intergenic
1074548353 10:114419693-114419715 GGGAAGTGGGCAGGAAGCCTGGG - Intergenic
1076309396 10:129493377-129493399 GGAAAAAGGAGAGTAAGCCAGGG - Intronic
1077279430 11:1735449-1735471 AGGAAATGGGCAGTCAGCCAGGG + Intronic
1078094428 11:8288030-8288052 GGGAAGTAGCAAATAAGCCAGGG - Intergenic
1078451831 11:11446324-11446346 GGAAAATGGAAAGGAAGCCAAGG - Intronic
1079332352 11:19544399-19544421 GGGTACTGACCAGTAAGCCTTGG - Intronic
1079381334 11:19940525-19940547 GGGAAATGAGTGGTAAGCCATGG + Intronic
1079763353 11:24357800-24357822 GGGGCATGGCCTGAAAGCCATGG - Intergenic
1081583013 11:44365400-44365422 GGGATAAGGCCTGTAAGGCAAGG + Intergenic
1084340181 11:68493089-68493111 TGGAAATGCCCAGTAAGCACCGG - Intronic
1084499973 11:69529719-69529741 AGGAAATGGAGAGCAAGCCACGG + Intergenic
1085228255 11:74942194-74942216 GGGAGCTGCCAAGTAAGCCAAGG + Intronic
1088885359 11:114001674-114001696 GGGAAATGGGGAGGGAGCCAAGG - Intergenic
1089370302 11:117950791-117950813 GGGAACTGGGCAGTAAACCCTGG + Intergenic
1089525229 11:119092821-119092843 GGGAAATGGGCGGGAAGCCAGGG + Intronic
1089647422 11:119889402-119889424 GGGAAAGGGGCAGAAAGTCAGGG - Intergenic
1090319284 11:125828182-125828204 GAGGAATGGGCAATAAGCCAAGG + Intergenic
1090478204 11:127043872-127043894 TGGAAATGTCCAGTAAGCAGTGG + Intergenic
1091172286 11:133529834-133529856 GAGAAGTCGCAAGTAAGCCATGG + Intronic
1091929020 12:4379649-4379671 AGGAAAAGGCCAGTAAGGCCTGG - Exonic
1093029143 12:14272091-14272113 GGGAAAGGGGCAGTAAGACAGGG + Intergenic
1094176901 12:27550205-27550227 GGGAGCTGGGCAGTAATCCAAGG + Intronic
1095670857 12:44858405-44858427 GGGAAAGGGTGAGTAACCCAGGG - Intronic
1099690677 12:85947610-85947632 GGGCAAAGGCAAGAAAGCCATGG + Intergenic
1100511356 12:95277663-95277685 GGCAAATGGCTAGTCAGTCAGGG - Intronic
1101830839 12:108255232-108255254 GAGAAATGAACAGTCAGCCAGGG + Intergenic
1103105012 12:118216366-118216388 GCCAAATGACCAGTATGCCAAGG - Intronic
1105284917 13:18995846-18995868 GGCAAAAGGCCAGAAAGCCAGGG + Intergenic
1109739438 13:66532789-66532811 GGAGAATGGCTAGTAAGACATGG - Intronic
1110214203 13:73008262-73008284 GGTAAATAACCAGTAAGGCATGG - Intronic
1111903592 13:94229963-94229985 GGGAAATGAACAGGAAGCCAGGG + Intronic
1112569712 13:100582642-100582664 AGGAAAGGGCCAATAAGCCAAGG + Intronic
1114302931 14:21394313-21394335 GGCACATGGCCACAAAGCCATGG + Exonic
1114803338 14:25804812-25804834 GGGAAATGACAAGCTAGCCAAGG - Intergenic
1116010582 14:39347070-39347092 GAAAAATGACCAGTAAGACAAGG + Intronic
1116118025 14:40682340-40682362 GGGACATGGCCTGAAAGCCACGG - Intergenic
1118818539 14:69329409-69329431 TAGAAATGGCCAATAAGCCTAGG + Intronic
1119351202 14:73967186-73967208 GGGCAATGGCCAATGGGCCATGG - Intronic
1119788254 14:77328286-77328308 GGGAAAGGGCCAGAATGGCAGGG + Intronic
1121382879 14:93489794-93489816 GGGCAATGCCCAGCAAGCCATGG - Intronic
1122359647 14:101151717-101151739 GGGAAATGGTGAGCAAGGCAGGG - Intergenic
1126841759 15:52724284-52724306 GGAAAATGGCCAGAGAGGCAAGG - Intergenic
1128319112 15:66680259-66680281 GGGAAATGCCCAGCAAGACTGGG + Intronic
1128505849 15:68272121-68272143 GGGAAATGGCCTCAAGGCCAGGG + Intergenic
1128567720 15:68712089-68712111 GGGAAATGGCTAGGGTGCCAAGG + Intronic
1129140470 15:73593435-73593457 GGGAAATGGGAAGTCAGTCAAGG - Intronic
1129343662 15:74902871-74902893 GGGACATGGACAGGAAGCCCTGG - Intronic
1129358883 15:75012082-75012104 GGCAGATGGACAGTAAGACAAGG - Intronic
1129489165 15:75906233-75906255 TGGAATTGGCCATTAAGCCCTGG + Intronic
1130061624 15:80574551-80574573 GGGAAATGGCCAAGAAGCCAAGG - Intronic
1130604815 15:85306589-85306611 GGGGCATGGCCTGAAAGCCATGG + Intergenic
1132093505 15:98965091-98965113 GGGAAATGGCATGTATGGCAAGG + Intergenic
1132844577 16:1993904-1993926 GGGACTGGGCCAGGAAGCCAAGG - Exonic
1133247585 16:4459459-4459481 GGGAGGTGACCAGTAAGCTAAGG - Intergenic
1133856772 16:9556989-9557011 AGGAGTTGGCAAGTAAGCCAGGG - Intergenic
1134588775 16:15434979-15435001 GGGAGATGGCCAGGCAGCTAAGG + Intronic
1137962620 16:52898165-52898187 GGGAAGTGGGAAGTAAGACAAGG - Intergenic
1138649904 16:58453979-58454001 GAGAAAGGGCCACAAAGCCAAGG - Intergenic
1139504408 16:67391905-67391927 GGCAAGGGGCCAGGAAGCCACGG - Exonic
1140453538 16:75090675-75090697 GGGAAATGGCGACTGTGCCATGG + Intronic
1141093629 16:81147521-81147543 GGGAAAGGGGCCATAAGCCAAGG + Intergenic
1141508397 16:84496145-84496167 GGGAAAGGGCAAGAAAGCCATGG - Intronic
1142809560 17:2388956-2388978 TGGACATGACCAGTAAGCCTGGG - Intronic
1144366476 17:14549583-14549605 AGGCGATGGCCAGTGAGCCAGGG + Intergenic
1146617824 17:34370641-34370663 GGGAAATGGGCTGTGAGCCATGG - Intergenic
1148029631 17:44610514-44610536 GGGAAATGGCCAGAACTGCAAGG - Intergenic
1148832689 17:50444793-50444815 GACAAATGGCCAGTAAGCATAGG - Intronic
1151401190 17:73857101-73857123 GGGAGGAGGCCAGGAAGCCAGGG + Intergenic
1152607411 17:81299691-81299713 GGGAAAGGGGCTGTGAGCCAGGG - Intergenic
1152693790 17:81733963-81733985 GGGACATGGCCAGCCAGGCAGGG + Intergenic
1155613436 18:27695133-27695155 GGGAAAGGGCAAGAAGGCCATGG - Intergenic
1156507979 18:37610769-37610791 TGGGACTGGCCAGCAAGCCATGG + Intergenic
1157453178 18:47802996-47803018 GGGATATGGCCAGTTGGCCAAGG + Intergenic
1158709162 18:59821832-59821854 GGAAAATCCCCACTAAGCCACGG - Intergenic
1158900792 18:61960189-61960211 GGGAAAATGCCAGCAAACCACGG + Intergenic
1158936239 18:62367156-62367178 TGGAAATGCCCTGTAAGCAAAGG - Intronic
1159344066 18:67175932-67175954 GGGATATGGCCGGCAAGCCTTGG + Intergenic
1163138144 19:15328444-15328466 GGGAAATGTCCAGTAGTGCATGG + Intronic
1165110852 19:33501172-33501194 GGGCAAAGGCCATTAGGCCATGG + Intronic
1165578092 19:36838661-36838683 GGGAACAGGACAGTAAGCCCAGG + Intronic
1166800256 19:45452356-45452378 GGGAGATGGACAGTAAACAAAGG - Intronic
1167794168 19:51698427-51698449 GGGATATACCAAGTAAGCCATGG - Intergenic
1168245183 19:55109587-55109609 GGAAAACAGCAAGTAAGCCAGGG + Intronic
925804659 2:7636304-7636326 GGCAAATGGAAAGTGAGCCAAGG + Intergenic
926573976 2:14560013-14560035 GGGGAATGGCCAGGCACCCATGG - Intergenic
926681702 2:15669089-15669111 GGGAAATGACAAGCAGGCCATGG + Intergenic
926883631 2:17576289-17576311 GGGAAATGGATAGTAAATCATGG - Intronic
927917685 2:26947357-26947379 GGCAACTGGCCAGTCAGCCAGGG - Exonic
928480299 2:31676158-31676180 GGGGAATGGCCTGAAAACCAAGG - Intergenic
928911494 2:36426594-36426616 AGAAAATGGGCAGTAAGTCAGGG + Intronic
929174035 2:38959594-38959616 GGGAAATGGCCTGCGGGCCAGGG - Intronic
929799636 2:45088711-45088733 GGGAACAGGCCAGAGAGCCAAGG + Intergenic
930676390 2:54205228-54205250 TGGATATTGCCAGTAACCCATGG + Intronic
930978648 2:57495018-57495040 GAGGAAGGGCCTGTAAGCCAAGG + Intergenic
931486554 2:62699319-62699341 GGGAAATGACCAGTAAGTCTTGG + Intronic
933531322 2:83516461-83516483 GGGATTTGGTCAGAAAGCCATGG - Intergenic
934681945 2:96290325-96290347 AGGAAATGTCCAGAATGCCAAGG - Exonic
936281475 2:111143985-111144007 TGGAAACTGCCAGTAAACCAAGG - Intronic
938998020 2:136701261-136701283 GAGCAATGTCCAGTAAGTCAGGG - Intergenic
939882247 2:147643594-147643616 GGGAAAAGGACAGGAGGCCAGGG - Intergenic
940692863 2:156941237-156941259 GGGAAAAAGGCAGTAAACCAAGG - Intergenic
940910122 2:159203138-159203160 GGGAACTGGAGAGTGAGCCAAGG - Intronic
946832889 2:223743623-223743645 GGGAAGGGGACAGTAAGCAAAGG - Intergenic
948348642 2:237320543-237320565 GGGAAAAGGCCAGTGATTCAAGG - Intergenic
1168861566 20:1049395-1049417 GGGAAATGGGGAGTTAGCAAAGG - Intergenic
1171234164 20:23510773-23510795 GGGAAGTGGCCAGTAAATGATGG + Intergenic
1173397878 20:42697491-42697513 AGGAAATGGTCAGTAAGATATGG + Intronic
1174449153 20:50609203-50609225 GGGAATTGGCCAGAATCCCAGGG - Intronic
1175469431 20:59216604-59216626 GAGAGATGGCCAGTGTGCCAGGG + Intronic
1175526296 20:59636538-59636560 GGGAGATGGCCAGGAAGACCTGG + Intronic
1178262525 21:31113312-31113334 GGGGAATGGACAGAAAGTCAAGG - Intergenic
1181375536 22:22454941-22454963 GGGAAAAGACCAGGGAGCCATGG + Intergenic
1181584403 22:23845168-23845190 GGTGAATGGCCAGTAAGGGAGGG + Intergenic
1182114252 22:27746087-27746109 GGAATATGCCCAGTAACCCATGG - Intergenic
1183185585 22:36289819-36289841 AGGAAATGGTCAGCAACCCATGG - Intronic
1183544029 22:38446208-38446230 GGAGAATGGCCAGCCAGCCACGG - Intronic
1184568164 22:45305841-45305863 GGGAAATGGACAGTGAACCCGGG - Intergenic
1185153862 22:49181774-49181796 CAGAAATGGCCAGAAAGCCTGGG - Intergenic
1185323016 22:50210507-50210529 GGGACAGGGCCAGAGAGCCACGG + Intronic
950090479 3:10291054-10291076 GAGAAAGGGCGAGTAAGCTAAGG - Exonic
953772671 3:45790891-45790913 GGGAAATGGCCAGAAACCCCAGG - Intronic
953929057 3:46996922-46996944 GGGGAATGGGCAGGCAGCCAGGG - Intronic
955044544 3:55347569-55347591 AAGACATGGCCAGCAAGCCATGG - Intergenic
955842282 3:63125140-63125162 GGTAAATGGAAAGTAAGGCAGGG - Intergenic
960056187 3:113278220-113278242 GGGAGAGGGCCAGACAGCCATGG + Exonic
961057606 3:123802376-123802398 AGGAAAGGCCCAGGAAGCCATGG - Intronic
963702128 3:148639463-148639485 TGCATATGGCCAGTATGCCATGG - Intergenic
969182039 4:5449636-5449658 GGTGAATGGCAAGTGAGCCAGGG + Intronic
971360008 4:25928981-25929003 ATTAAATGGCCAGGAAGCCATGG - Intronic
971574117 4:28252280-28252302 AGGAAAGGGCCCATAAGCCAAGG - Intergenic
972172223 4:36360258-36360280 GGAAAATGGCCAGTATGATAGGG + Intergenic
975846647 4:78532201-78532223 GAGGAATGACCAGTCAGCCAGGG - Intronic
976474547 4:85468842-85468864 GTGAATTGGCCAAAAAGCCAAGG - Intergenic
978759525 4:112341333-112341355 GGGAAATTGTCAGGAAGGCAAGG - Intronic
980552016 4:134350391-134350413 GGGAAATGCCCAATAGGCAAAGG + Intergenic
980840954 4:138260928-138260950 GGGAAATGGTCTGAAAGGCAGGG + Intergenic
981966906 4:150614829-150614851 GGGAAATGGCTACCCAGCCAGGG - Intronic
984884693 4:184440135-184440157 GGGAAGTGGCTACTGAGCCAGGG - Intronic
986373826 5:7109824-7109846 AGGAAATGGCGAGGAAGACATGG + Intergenic
987917145 5:24228820-24228842 GAGATATGGCCTGAAAGCCATGG - Intergenic
989038965 5:37207100-37207122 GGGAAAGGGACAGAAGGCCAGGG - Intronic
992078720 5:73215107-73215129 TGGAAATCTCCAGTCAGCCACGG + Intergenic
995434524 5:112120535-112120557 GGGAAATGTGAAGTAAGCAAGGG + Intergenic
996233194 5:121091928-121091950 GGGAAAGGGTGAATAAGCCAAGG + Intergenic
1001440291 5:171737685-171737707 GGAAAATGGCCAGAAACCAAGGG + Intergenic
1001999547 5:176189988-176190010 GGCAACTGGCCAGCAAGCCCAGG + Intergenic
1002533939 5:179865766-179865788 GGGAAAAGACCAGCAAGCAAGGG + Intronic
1002649620 5:180681918-180681940 GGCAACTGGCCAGCAAGCCCAGG - Intergenic
1003354026 6:5348411-5348433 GGGAAATGGCCAGTAAGCCAGGG - Intronic
1003983014 6:11407142-11407164 GAAAAATGGCCACTAAACCATGG - Intergenic
1004946032 6:20614422-20614444 GAGAAATGGCTAGTCATCCAGGG - Intronic
1005498493 6:26409762-26409784 GGGCTTTGGCCCGTAAGCCAGGG - Intronic
1009249192 6:61276952-61276974 GGTAAATGGCCAGTGACCCCTGG - Intergenic
1010461775 6:76121658-76121680 GGGAAATGGTCATTCAGACAAGG - Intergenic
1010739629 6:79484662-79484684 GAAAAATGGCAAGTCAGCCATGG + Intergenic
1016382677 6:143500780-143500802 GGGACAGGGACAGCAAGCCAGGG + Intronic
1016796784 6:148126287-148126309 GGGATATGGACGGAAAGCCAGGG + Intergenic
1016987075 6:149903675-149903697 GGGAAATGGGCCCTGAGCCATGG + Intergenic
1017674366 6:156797974-156797996 GAGGAATGCCCAGTAAGCCTGGG + Intronic
1019207663 6:170376386-170376408 GTGATAAGGACAGTAAGCCAAGG + Intronic
1021088053 7:16447184-16447206 GGGAAATGTCCCACAAGCCATGG - Intergenic
1022536447 7:31101547-31101569 GGAAAATGGCCAGAAACACAGGG - Intronic
1022903913 7:34837503-34837525 GGGAAATGGGCAATGGGCCATGG - Intronic
1027171407 7:75875478-75875500 AGGAAATGGCCAGTATAACATGG + Intronic
1032991782 7:137402318-137402340 GGGAAATGGTCTGAAAGCTAAGG + Intronic
1033022402 7:137739557-137739579 GGAAATTAGCAAGTAAGCCAGGG - Intronic
1034760141 7:153664706-153664728 GAGAAATGGCAAGGAGGCCAGGG + Intergenic
1035317008 7:158002662-158002684 GGGAAATGTCCAGGAATCCTGGG + Intronic
1036673335 8:10807833-10807855 GGGAAAAGTCCAGGAGGCCAGGG + Intronic
1039878043 8:41604264-41604286 GGGAAAGGAGCTGTAAGCCAGGG - Intronic
1046978695 8:120312698-120312720 TGGAAATGTCCAGCAGGCCAAGG - Intronic
1048501998 8:134986748-134986770 GGGAGGTGGCCAGTAAGTGATGG - Intergenic
1049413530 8:142484553-142484575 AGGAAATGGCCAATAAGAAAAGG + Intronic
1050310301 9:4345823-4345845 GGGAAGTGGGGAGTAAGGCAGGG + Intronic
1050651815 9:7784978-7785000 CAGAAATGGCCCCTAAGCCAGGG - Intergenic
1051121881 9:13760597-13760619 GGGTAATGCCCCATAAGCCAGGG + Intergenic
1055002298 9:71465633-71465655 GGGGAATGGGCAGTGAGTCATGG + Intergenic
1055195637 9:73589690-73589712 GGGACATTGCCAGGAAGCCTGGG + Intergenic
1056551803 9:87658941-87658963 GGGATATGGCCCGTGGGCCATGG - Intronic
1057287374 9:93768905-93768927 GGGAAATGGCCAGTCAGTGGAGG + Intergenic
1058840994 9:108908939-108908961 AGGAAATAGCCAGGAGGCCAGGG - Intronic
1059669302 9:116477898-116477920 GAGAGATGGACAGGAAGCCAGGG + Intronic
1059779508 9:117511515-117511537 TGGAAATGGCAATTAAGCCCAGG + Intergenic
1060872968 9:127057411-127057433 GAGAATTGGCCATTAAGCTAGGG + Intronic
1062471159 9:136705610-136705632 TGGCAATGGCTACTAAGCCATGG + Intergenic
1190824256 X:54002497-54002519 GGGACATGGCCAGAAAGGAATGG - Intronic
1191253007 X:58268285-58268307 GGGACAGGGCCAGGACGCCAGGG - Intergenic
1191671796 X:63755086-63755108 GGGATAGGGCCAGCAAGGCAGGG - Exonic
1193461043 X:81791127-81791149 GGGCAATGGCCTAAAAGCCATGG - Intergenic
1193579865 X:83251605-83251627 GGGGCATGGCCTGTAAGCCATGG + Intergenic
1197047682 X:122018870-122018892 TAGAAATGACAAGTAAGCCAAGG - Intergenic
1198385079 X:136121431-136121453 TGGAAATAGCCAGTCACCCAAGG - Intergenic
1200136989 X:153880002-153880024 GGGAAAGGGCCAGGGAGGCAAGG + Intronic
1200801708 Y:7393078-7393100 GGGAAATGACAGGTAAGACAGGG + Intergenic
1201763737 Y:17562143-17562165 GGGAAATAAGCAGTAAGCCAGGG - Intergenic
1201837816 Y:18343847-18343869 GGGAAATAAGCAGTAAGCCAGGG + Intergenic