ID: 1003354538

View in Genome Browser
Species Human (GRCh38)
Location 6:5354801-5354823
Sequence CCGCGCCCGGCCTATGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003354526_1003354538 24 Left 1003354526 6:5354754-5354776 CCACCTGCCTCGGCCTCCCAAAG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107
1003354534_1003354538 7 Left 1003354534 6:5354771-5354793 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107
1003354531_1003354538 11 Left 1003354531 6:5354767-5354789 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107
1003354533_1003354538 8 Left 1003354533 6:5354770-5354792 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107
1003354529_1003354538 17 Left 1003354529 6:5354761-5354783 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107
1003354527_1003354538 21 Left 1003354527 6:5354757-5354779 CCTGCCTCGGCCTCCCAAAGTGC 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
Right 1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG 0: 1
1: 0
2: 2
3: 16
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003354538 Original CRISPR CCGCGCCCGGCCTATGCTAG TGG Intronic
902470396 1:16644771-16644793 CCGCGCCCAGCCTCCGCTAGGGG + Intergenic
902569569 1:17338517-17338539 TCGTGCCCGGCCTATGGCAGAGG - Intronic
902592923 1:17487922-17487944 CCACGCCCGGCCTAGGCTAGGGG + Intergenic
910253917 1:85228013-85228035 CCGCGCCCAGCCGATGTTGGAGG - Intergenic
914435157 1:147653115-147653137 CCGCGCCCGGCCTGTTTTACTGG + Intronic
915439418 1:155935522-155935544 CCGCGCCCTGCCGAGGCTAAAGG + Intergenic
916798650 1:168192606-168192628 CCGCGCCCGGCCTAATTGAGAGG - Intronic
918519879 1:185403964-185403986 CCGCGCCCGGCCGAATCTTGGGG - Intergenic
923700231 1:236293057-236293079 CCGCGCCAGGCCCATCCTGGGGG + Intergenic
924521044 1:244806432-244806454 CCACACCCGGCCTCTCCTAGTGG - Intergenic
1063472898 10:6302668-6302690 CCGTGCCCGGCCCATACTTGTGG + Intergenic
1064177368 10:13086734-13086756 CCGCGCCCGGCCTCTGTAAAAGG + Intronic
1064247826 10:13683292-13683314 CCAGGCCCGGCCTATTCTTGTGG - Intronic
1066339732 10:34519521-34519543 CCGCGCCTGGCCTACGCTTTGGG - Intronic
1067260815 10:44689582-44689604 CCTCTCCCTGCCTATGGTAGTGG - Intergenic
1069972760 10:72187428-72187450 CCGCGCCCGGCCTAAGAGAAGGG - Intronic
1070622932 10:78027845-78027867 CCACTCCTGGCCTCTGCTAGAGG + Intronic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1077613021 11:3656222-3656244 CCGCGCCCGGCCCAGGGAAGTGG + Intronic
1078128861 11:8594988-8595010 CTGCGCCCGGCCTAGTCCAGTGG - Intergenic
1079250854 11:18786490-18786512 CCGCACCCGGCCTAGAATAGGGG + Intronic
1081117595 11:39223342-39223364 CCGTGCCCGGCCTTTTCTTGGGG - Intergenic
1083703847 11:64499736-64499758 CCGTGCCAGGCCTTTGCTATGGG - Intergenic
1084198536 11:67540509-67540531 CAGCGCCCAGCCTAAGCTCGAGG + Intergenic
1089729411 11:120511389-120511411 CGGCGCCCGGCAGAGGCTAGGGG - Intergenic
1092617826 12:10231695-10231717 CCGCCCCCTCCCTATGCTATAGG + Intergenic
1093474039 12:19534985-19535007 CCGTGCCCAGCCAAGGCTAGGGG + Intronic
1094660838 12:32469114-32469136 TTGCGCCCGGCCTATTCTGGTGG + Intronic
1111591585 13:90354207-90354229 CCACGCCGGGCCCATGCTTGGGG - Intergenic
1114861748 14:26531315-26531337 CCGCGCCCAGCCTCTCCTAGAGG - Intronic
1118052429 14:62043961-62043983 CCATGCCTGGCCTATGCTATAGG + Intronic
1119436890 14:74603415-74603437 CCGCTCCCGGCCCCAGCTAGAGG + Intronic
1122089579 14:99329311-99329333 CCGCGCCCGGCCAAGGAAAGAGG - Intergenic
1123026508 14:105426758-105426780 TCGCGCCCGGCCCATCCTTGGGG - Intronic
1125035721 15:35121756-35121778 CCACGCCCGGCCGATGGTGGTGG - Intergenic
1125449174 15:39790540-39790562 CCGTGCCCGGCCCTCGCTAGAGG - Intergenic
1126261601 15:46699713-46699735 CCGCGCCTGGCCTGTGATAAAGG - Intergenic
1131140108 15:89970459-89970481 CCACGCCCGGCCTCTCATAGAGG - Intergenic
1134380291 16:13718141-13718163 CCGCGCCCGGCCTCTGTTTTGGG + Intergenic
1137618239 16:49858964-49858986 CCGCGGGCTGCCTCTGCTAGAGG + Intergenic
1139953625 16:70683425-70683447 CCTGGCCAGGCCTCTGCTAGGGG - Intronic
1141767084 16:86065787-86065809 CCGAGCCCTGCCTCTGGTAGAGG - Intergenic
1142235938 16:88922583-88922605 CCACGCCAGGGCTATGCTTGAGG + Intronic
1142579954 17:935800-935822 CTGCGCCCGGCCTAGGCTGCAGG - Intronic
1143422889 17:6809520-6809542 CCGCGCCCAGCCGATTCTATGGG + Intronic
1143669170 17:8384392-8384414 CCGCGCCCGGCCCCTGCAAATGG + Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147186596 17:38716568-38716590 CCGGGCCCGGCCTGAGCTGGAGG - Exonic
1151648722 17:75452135-75452157 CCGCGCCCGGCCTAGGCAGAAGG + Intronic
1151818503 17:76483969-76483991 CCGCGCCCGGCCACAGCTGGGGG - Intronic
1152389684 17:79995493-79995515 CCGCGCCCGGCCGATCCTGAAGG - Intronic
1152464812 17:80460024-80460046 CCGCGCCCGGCCTTTCATTGTGG - Intergenic
1153041188 18:813822-813844 CTGTGCCCGGCCTATTTTAGAGG - Intergenic
1158136960 18:54218670-54218692 CCGCGCCCAGCCTATCATACTGG - Intronic
1158644868 18:59237158-59237180 CCGCGCCCGGCCTGAGCTGAGGG - Intergenic
1160721591 19:599487-599509 CCGCGCCCGGCCAATTCTTGAGG - Intronic
1160747853 19:720165-720187 CCGCCCCCGGCCTGTGCTTGGGG - Intronic
1161110585 19:2467453-2467475 CCACGCCCAGCCTAGGTTAGGGG - Intergenic
1161398145 19:4055530-4055552 CCGCGCCAGGCCGAGGCCAGGGG - Intronic
1162391697 19:10393799-10393821 CCGCGCCCGGCCTAGCCTCTAGG - Intronic
1162706765 19:12560893-12560915 CCGCGCCCGGCCTTCTGTAGGGG + Intronic
1167937114 19:52918197-52918219 CCGCACCCAGCCTCTGCAAGTGG - Intergenic
1168054459 19:53854298-53854320 CCGCGCCTGGCCTAAGGCAGAGG + Intergenic
1168341063 19:55623322-55623344 CCGCGCCCGGCCCATCCTCCAGG + Intronic
926922951 2:17957575-17957597 CCGGGCTCTGCCTATGCTTGGGG + Intronic
937877523 2:126836800-126836822 GCGTGCCAGGCCTACGCTAGGGG + Intergenic
939589988 2:144052937-144052959 CCACGCCCGGCCTATTTTAAAGG + Intronic
940318471 2:152349123-152349145 CCGCGCCCGGCCACTTCTAAGGG + Intronic
940768805 2:157818786-157818808 CCGCGCCCGGCCGATCTTACTGG - Intronic
1169177716 20:3533050-3533072 CCACGCCCAGCCTATGGTATGGG + Intronic
1171767914 20:29300424-29300446 CCGCGCCCGCCACGTGCTAGTGG - Intergenic
1172428283 20:34871056-34871078 CCGCGCCCGGCCTATGGATAAGG + Intronic
1179338480 21:40481197-40481219 CCGCACCCGGCCTGTTCTTGTGG - Intronic
1180992338 22:19944253-19944275 CCGGGCCCGGCCTATCCTTGAGG - Intronic
1182358001 22:29730882-29730904 CCTTGCCCGACCTCTGCTAGGGG + Exonic
949598929 3:5577797-5577819 CCGCGCCCGGCCGGGGTTAGTGG + Intergenic
954299025 3:49689459-49689481 CCGCGCCCAGCCTCCGCTAGGGG - Intronic
954700665 3:52449176-52449198 CCGTGCCCGGCCTAATCTGGTGG - Intergenic
957175444 3:76802436-76802458 CCGCGCCCGGCCTCTGAAGGTGG - Intronic
963132650 3:141872925-141872947 CCTCGCCCGGCCTACTGTAGAGG + Intergenic
966693707 3:182767578-182767600 CCGCGCCCGGCCTATGAAATAGG + Intergenic
968234541 3:197023970-197023992 CTGCGCCCGGTCTATACTGGTGG + Intronic
969186651 4:5479407-5479429 CCATGCCCGGCCTAGTCTAGGGG + Intronic
969508684 4:7604587-7604609 CCGCGCCCGGCCTATGGTGATGG + Intronic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
975557086 4:75675500-75675522 CCGCGCCCGGCCTATATCAGTGG - Intronic
977395259 4:96463187-96463209 CCGCGCCCGGCCTATCGTGAAGG + Intergenic
979166137 4:117533943-117533965 CCGCGCCCTGCCTAGGGGAGAGG - Intergenic
980930441 4:139178021-139178043 CTACGCCCGGCTTTTGCTAGCGG - Intergenic
992114032 5:73522516-73522538 CCGTGCCTGGCCTATGCCAAGGG - Intergenic
993930842 5:93937161-93937183 CCGCGCCCGGCCAATTATAAAGG + Intronic
999637785 5:153640584-153640606 CTGTGCCCGGCCTCTGCTAAAGG + Intronic
1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG + Intronic
1003898269 6:10628728-10628750 CCACGCCCGGCCCAAGCCAGAGG - Exonic
1005098145 6:22141066-22141088 CCGCGCCCGGCCTTAGCTCAGGG + Intergenic
1006378113 6:33683054-33683076 CCCACCCCGGCCTATGCTTGAGG - Intronic
1009382494 6:63049828-63049850 CCATGCCTGGCCTATGCTTGTGG - Intergenic
1009617203 6:66024955-66024977 CCGTGCCCGGCCTGAGTTAGTGG - Intergenic
1013211787 6:107993427-107993449 CCTCGCCCGGCCGATGGCAGGGG + Intergenic
1021593485 7:22290453-22290475 CCGCGCCCGGCCTTTCATTGTGG - Intronic
1022106937 7:27203472-27203494 CCGCTGCCGGCCGATCCTAGTGG - Intergenic
1022905424 7:34850688-34850710 CCGCGCCCGGCCTGTCCTTGAGG + Intronic
1023546796 7:41326036-41326058 CTGCGCCCGGCCTATGCCACTGG + Intergenic
1024873995 7:53999884-53999906 CTGCGCCTGGCCTATGCTATAGG + Intergenic
1033219495 7:139518930-139518952 CCGCGCCCGGCCTAGGGCGGGGG + Intergenic
1034195371 7:149242312-149242334 CCGCACCCGGCCTAAGGCAGAGG + Intronic
1034428718 7:151029031-151029053 CCGCGCCCGGCCTATTAGATTGG - Intronic
1035476038 7:159144841-159144863 TCGCTCCCGGCCCATGCTGGAGG - Exonic
1041006987 8:53505036-53505058 CCGCGCCTGGCCTGTGCTGGTGG - Intergenic
1041326002 8:56665094-56665116 CCGCGCCCGGCCCAGGGTGGTGG + Intergenic
1043872625 8:85451072-85451094 CCGCGCCCGGCCAAGACTAAGGG + Intergenic
1045111846 8:98944320-98944342 CCGCGCCCGGCGTCTGCTAATGG - Intergenic
1049095926 8:140548023-140548045 CCGCGCCCGGCCAGTGTAAGTGG - Intronic
1051625013 9:19091008-19091030 CTGCGCCCGGCCAATTCTGGTGG - Intronic
1053251157 9:36574844-36574866 CCGCGCCCGGCCTATAATTGGGG - Intronic
1055402063 9:75934411-75934433 CAGGGCCTGGCATATGCTAGGGG - Intronic
1058322140 9:103645673-103645695 CCGCGCCCGGCCAAGACTGGAGG + Intergenic
1059571888 9:115446518-115446540 CCGCGCCCGGCCTGAGATACTGG + Intergenic
1061558379 9:131386405-131386427 CTGCGCCTGGCCTATGCCTGTGG + Intergenic
1062600244 9:137316091-137316113 CCGCGCCCCGCCGAGGCTGGGGG - Intronic
1185610807 X:1392749-1392771 CCGCGCCCGGCCTAGGTTGGTGG + Intergenic
1190156237 X:47995039-47995061 CCGCGCCCGGCCTCTTCTGCTGG - Intronic
1196507158 X:116460856-116460878 CCGTGCCCGGCCCATTCTAAGGG + Exonic
1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG + Intronic
1198826861 X:140707465-140707487 CCGTGCCCGGCCTATACTGAAGG + Intergenic
1199280960 X:145998916-145998938 CCGCGCCTGGCCAAATCTAGTGG - Intergenic