ID: 1003354978

View in Genome Browser
Species Human (GRCh38)
Location 6:5359800-5359822
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003354970_1003354978 18 Left 1003354970 6:5359759-5359781 CCTAAAAATACTTACATTTATCC 0: 1
1: 0
2: 1
3: 44
4: 410
Right 1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG No data
1003354969_1003354978 26 Left 1003354969 6:5359751-5359773 CCATTTGACCTAAAAATACTTAC 0: 1
1: 0
2: 1
3: 26
4: 299
Right 1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG No data
1003354972_1003354978 -3 Left 1003354972 6:5359780-5359802 CCATGGAAGCCAAGAGCATTTGT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr