ID: 1003359766

View in Genome Browser
Species Human (GRCh38)
Location 6:5413643-5413665
Sequence AAGGAGTGAAGGAGTTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 792}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003359766_1003359768 -10 Left 1003359766 6:5413643-5413665 CCACTTTAACTCCTTCACTCCTT 0: 1
1: 0
2: 1
3: 50
4: 792
Right 1003359768 6:5413656-5413678 TTCACTCCTTTGACTTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003359766 Original CRISPR AAGGAGTGAAGGAGTTAAAG TGG (reversed) Intronic
900069869 1:762669-762691 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
900462078 1:2806356-2806378 AAGGTGTGAAGGAAGGAAAGAGG + Intergenic
900466430 1:2827769-2827791 AAGGAGAGAAGGAGAGAGAGGGG + Intergenic
900918547 1:5656134-5656156 AAGGAGGGATGGAGAGAAAGAGG + Intergenic
901519120 1:9769100-9769122 AAGGAGGGAAGGAGAGAGAGAGG + Intronic
901519141 1:9769166-9769188 AAGGAGGGAGGGAGGTAAGGAGG + Intronic
901833167 1:11906433-11906455 AGGGAGAGAAGGATTAAAAGGGG + Intergenic
901895793 1:12310864-12310886 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895796 1:12310872-12310894 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895799 1:12310880-12310902 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901895802 1:12310888-12310910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
901914054 1:12484279-12484301 AAAGAGTGAAGGAGGTAAGTGGG - Intronic
902259285 1:15212426-15212448 AGGCAGTGAGGGGGTTAAAGCGG + Intronic
902767341 1:18626188-18626210 AAGAAGAGAAGGAGAAAAAGAGG + Intergenic
902793908 1:18787926-18787948 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
903049737 1:20591618-20591640 AAGGAATGGAGGAGATAAACAGG + Intronic
903331683 1:22599978-22600000 AAGGAGAGAAGGAGGAAAGGAGG + Intronic
903391506 1:22966857-22966879 AGGGATTGAAGGAGATAGAGGGG - Intergenic
904017211 1:27431299-27431321 AAAGAGGGAAAGAGTTAAATTGG - Intronic
904318215 1:29679779-29679801 AAGAAGAGAAGGAGGGAAAGAGG - Intergenic
904348718 1:29891138-29891160 AAGGAGTGAAGGAGAGAGAGAGG + Intergenic
904480637 1:30791288-30791310 AGGGAGGGAAGGAGGAAAAGAGG + Intergenic
904480656 1:30791374-30791396 AAGGAGAGAAGGAGGAAGAGAGG + Intergenic
904961358 1:34335673-34335695 AAGGCAGGAAGGAGTTCAAGGGG + Intergenic
905009463 1:34737388-34737410 AAGGAGTCAATGAGATAATGCGG + Intronic
905070750 1:35223287-35223309 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
905460337 1:38118679-38118701 AAGGAGAGAAGGAAAGAAAGAGG - Intergenic
905539606 1:38749442-38749464 AAGGAGAGGAGGAGTGAAGGGGG + Intergenic
906243205 1:44255235-44255257 AGGGAGTGAAGGAGTGAAGGAGG - Intronic
906558915 1:46739558-46739580 AAGGAGGGAAGAAGGGAAAGAGG - Intergenic
906764785 1:48418798-48418820 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
906819629 1:48915758-48915780 AAGGATAGAAGGAATCAAAGAGG + Intronic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
907815867 1:57917774-57917796 AGGGGGCGAAGGAGTTAAAAAGG - Intronic
907996202 1:59635301-59635323 AAGGAGGTTAGGAGTCAAAGGGG + Intronic
908514247 1:64875935-64875957 AAGGAGTGAACCAGCTACAGAGG + Intronic
909046127 1:70711982-70712004 AAGAAGTGAAGGAGCTAGAAGGG - Intergenic
909431052 1:75588241-75588263 AAGGAGTGAAGGAGGGAAGGAGG + Intronic
910188518 1:84571729-84571751 AAGGACTGTAGGGGTTACAGGGG + Intronic
910204514 1:84734782-84734804 AAGGAGAGAATGAGGTATAGAGG + Intergenic
910224798 1:84925448-84925470 AAGCAGTGAAGGATATACAGGGG - Intergenic
910521261 1:88124725-88124747 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
910735038 1:90444352-90444374 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
910998549 1:93136067-93136089 AATGAGTGAAGGGGTTAGACTGG - Intronic
911277709 1:95881618-95881640 AAGAAGTGGAGGAGTTCATGAGG - Intergenic
911524659 1:98969717-98969739 AAGGAAGGAAGGAGAAAAAGAGG - Intronic
912067213 1:105758432-105758454 CAGGAATGAAGGAGTGGAAGTGG + Intergenic
913167213 1:116199429-116199451 AGGATGTGAAGGACTTAAAGTGG - Intergenic
913395383 1:118364632-118364654 AAGGAGATAAGGAGGTAAAGAGG - Intergenic
916608799 1:166369628-166369650 AGGGAGTGAAGGAGGAAAGGAGG - Intergenic
918665606 1:187146800-187146822 AAGGAGGGAAGGAGGGAACGAGG - Intergenic
919221132 1:194629906-194629928 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
919221134 1:194629914-194629936 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
919234431 1:194821238-194821260 AAGGGGTTAAGAAATTAAAGTGG + Intergenic
919673634 1:200360442-200360464 CACCAGTGAAGGAGTTCAAGTGG - Intergenic
920634482 1:207686180-207686202 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
920792177 1:209103761-209103783 AAGGAGTAAAGGAGGATAAGGGG - Intergenic
920841924 1:209562365-209562387 AAGGAGAGAAGGAGGGAAAAAGG + Intergenic
921082825 1:211756703-211756725 TAGGAGTAAAGGTGTTAAAAGGG - Intronic
921544112 1:216453831-216453853 GAGGAGTAAATGAGTTAAACAGG - Intergenic
922039019 1:221877426-221877448 AAGGAAGGAAGGAGATAAAGTGG - Intergenic
922207493 1:223461289-223461311 AAGGATTGGAGGATTTAATGAGG - Intergenic
922265552 1:223980657-223980679 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
922967120 1:229699578-229699600 AAGGAGGGAAGGCTTTAATGGGG + Intergenic
924347412 1:243085656-243085678 AAGGAGGGAAGGAGGGAAAAAGG + Intergenic
924602573 1:245504375-245504397 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1063114044 10:3060795-3060817 AATGAGTGATTGAGTAAAAGGGG - Intergenic
1063668915 10:8083938-8083960 AAGGAGAGGAGGAGAAAAAGAGG + Intergenic
1063681455 10:8191761-8191783 AATGAGTGAATGAGTGAATGAGG - Intergenic
1064185768 10:13160823-13160845 AAGGGGGGAAAGACTTAAAGTGG + Intergenic
1064210510 10:13357231-13357253 AAGGAGGGAAGGAGGGAGAGAGG - Intergenic
1064541439 10:16409606-16409628 AAGGAGTGAAGGAGGGAGTGAGG + Intergenic
1064587671 10:16854953-16854975 AAGGAGTGAGGGAGGAAGAGAGG - Intronic
1065484810 10:26227511-26227533 AAGGAGGGAAGAAGAGAAAGGGG - Intronic
1065874328 10:29983844-29983866 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1066468726 10:35676719-35676741 AAGGAATTAAAGAGTTAAAGTGG + Intergenic
1068099245 10:52531449-52531471 AAGGAGTGTGGGAGGTAAGGAGG - Intergenic
1068250728 10:54436080-54436102 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1068631019 10:59297728-59297750 AGGGAGTGAATGAGATAGAGGGG - Intronic
1069414424 10:68185163-68185185 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069414427 10:68185171-68185193 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1069990220 10:72310598-72310620 AAGGAGAGACTGAGTTGAAGAGG - Intergenic
1070219304 10:74423711-74423733 AATGGGTGAAGGAGCTAGAGAGG - Intronic
1070476568 10:76834950-76834972 AAGGAGAAAAGGAGGTGAAGAGG - Intergenic
1070987003 10:80697768-80697790 AAGGAGGGAAGGAAGGAAAGAGG - Intergenic
1071871528 10:89800426-89800448 AAGGAGGGAAGGAAGTGAAGGGG + Intergenic
1071965043 10:90843738-90843760 AAGGAGGGAAAGAATTAAATGGG + Intronic
1072043415 10:91631256-91631278 AAGGAGGGAAGGAGGAAAGGAGG - Intronic
1072442418 10:95468753-95468775 AAGGACTGAAGGAAATAAGGAGG + Intronic
1072594960 10:96862780-96862802 AAGGATTTTAGGAGTTAAAGAGG + Intronic
1073040615 10:100602006-100602028 AAGGAGTGAGAGGGTCAAAGGGG - Intergenic
1073277785 10:102327528-102327550 TGGGAGTGAAGGACTTACAGAGG + Intronic
1073558415 10:104476049-104476071 AGGGAATGATGCAGTTAAAGGGG + Intergenic
1074326433 10:112455436-112455458 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326436 10:112455444-112455466 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074326439 10:112455452-112455474 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1074559064 10:114519101-114519123 AAGCAGAGAAGTAGTTCAAGAGG + Intronic
1074825589 10:117213514-117213536 AAGGAGTGAAGAAGTGAGACAGG - Intergenic
1074842111 10:117364893-117364915 AAGGAAGGAGGGAGTGAAAGTGG + Intronic
1075383228 10:122035808-122035830 AAGGAAGGAAGGAGGGAAAGAGG - Intronic
1075679750 10:124323583-124323605 GAGGAGGGAAGGAGAGAAAGGGG + Intergenic
1075884507 10:125886315-125886337 AAAAAATGAAGCAGTTAAAGAGG - Intronic
1076293571 10:129366322-129366344 AAAGAGGGACGGAGTTAATGTGG + Intergenic
1076527415 10:131120824-131120846 AAGGAGTGAAGGAGCAGGAGGGG - Intronic
1077070321 11:667409-667431 AAGGAGGGAAGGAGGAAAAGAGG + Intronic
1077779272 11:5307666-5307688 AAGGAGGGAAGGAGGGAAGGGGG - Intronic
1078198463 11:9156833-9156855 AAGGAGGGAAGGAGGGACAGAGG + Intronic
1078463595 11:11533827-11533849 AAGGAGAGCAGGAGATAATGAGG - Intronic
1078849924 11:15154475-15154497 AAGGAGTCAGAGAGTTGAAGAGG + Intronic
1079323807 11:19474586-19474608 ATGGAGTGAAGGAGTGGATGAGG + Intronic
1080135084 11:28844759-28844781 AAGGAGAGAAGGAGAGAAGGAGG - Intergenic
1081187305 11:40059650-40059672 AAGAAGTGAAGAAGGTAAGGTGG + Intergenic
1081796846 11:45826333-45826355 ATGAAGTGAAGGATGTAAAGAGG - Intergenic
1082281496 11:50275507-50275529 AAGGAGGGAAGGAAGGAAAGGGG + Intergenic
1083421245 11:62554466-62554488 AAGGGGTGAAGGAGGGAATGTGG - Intronic
1084273379 11:68040381-68040403 AAGGAGAGAAGGAGGGAACGAGG - Intronic
1085207530 11:74745218-74745240 AAGGAGGGAAGGAAGGAAAGAGG + Intergenic
1085234164 11:74999383-74999405 AAAGAGAGAATGAGTTAAAGTGG - Intronic
1085992246 11:81863313-81863335 AAGGAGAGAAAGAGAGAAAGAGG + Intergenic
1086222946 11:84471563-84471585 AAGGGGAAAAGGAGTGAAAGGGG + Intronic
1086242511 11:84712406-84712428 AATGAGCTAAGGAGTTAAACAGG - Intronic
1086393276 11:86388185-86388207 AAGGAGGGAAGGAGGAAAGGAGG - Intronic
1086393278 11:86388193-86388215 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1086530632 11:87780703-87780725 CAGGAATCAAGGAGTGAAAGTGG - Intergenic
1086873489 11:92067545-92067567 AAGGAGCGGGGGAGATAAAGAGG - Intergenic
1087158955 11:94930539-94930561 ATGGAGTAAAGGGGCTAAAGTGG + Intergenic
1087237172 11:95733044-95733066 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1087906094 11:103699691-103699713 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1088365605 11:109036963-109036985 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
1088397874 11:109388756-109388778 AAGGAGAGGAGGAATTAAGGTGG - Intergenic
1088822342 11:113467145-113467167 AATGAGTGAAAGAGTTGAAAGGG + Intronic
1088920049 11:114254106-114254128 AATGAGTGAAGGAGTGAATAGGG - Intergenic
1088933514 11:114376252-114376274 AAAGTGTGAAGGAGAAAAAGAGG + Intergenic
1088976392 11:114820060-114820082 AAGGTGGGAAGGAGATAAAATGG + Intergenic
1089029380 11:115308759-115308781 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1089154395 11:116389736-116389758 ATGGAGCTAAGGAGGTAAAGGGG + Intergenic
1089196294 11:116695746-116695768 AAGGAAAGAAGGAGAGAAAGAGG - Intergenic
1089921592 11:122214023-122214045 TAGGAGGGAAAGAGTAAAAGAGG - Intergenic
1090134522 11:124183539-124183561 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1090386363 11:126359732-126359754 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090386366 11:126359740-126359762 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1090634636 11:128683352-128683374 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1090939660 11:131375914-131375936 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1091343017 11:134834667-134834689 AAGGAGTGAAGTACTGACAGAGG + Intergenic
1091485129 12:879361-879383 AAGGAGAGCAGGAGAGAAAGAGG - Intronic
1091568423 12:1663797-1663819 AAGGAGGGAAGGAGGAAAACAGG + Intergenic
1092109310 12:5947639-5947661 AAGGAGTGGAGGAGGGACAGTGG + Intergenic
1092200935 12:6582292-6582314 AAGTAGAGAAAGAGTTAAATAGG + Intronic
1092753202 12:11738233-11738255 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1092964617 12:13629618-13629640 GAGGAGGGAAGGAGGGAAAGAGG - Intronic
1093838601 12:23868044-23868066 AGGGAGAGAAGGAGGGAAAGAGG - Intronic
1094615076 12:32029232-32029254 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1095684038 12:45011902-45011924 AAGAAGTGAAGGAGCTACAAGGG + Intergenic
1095700923 12:45190079-45190101 AAGGAGGGAAGAAGGGAAAGAGG - Intergenic
1095920969 12:47530866-47530888 AAGGAGAGAAAGAGTTCAAATGG - Intergenic
1096749572 12:53750238-53750260 TAGGAGTGGGGGAGTTAGAGAGG + Intergenic
1096943185 12:55372453-55372475 AAGGAGGGAAGGAGGAAAGGAGG + Intergenic
1096944176 12:55385965-55385987 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1097020777 12:56019448-56019470 AAGGAGGGAAGGAGTTGGAATGG + Intronic
1098567922 12:71956472-71956494 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567935 12:71956508-71956530 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567944 12:71956536-71956558 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1098567959 12:71956584-71956606 AAAGAGGGAAGGAGGGAAAGAGG - Intronic
1098567964 12:71956600-71956622 AAGGAAGGAAGGAGAGAAAGAGG - Intronic
1098891263 12:76012528-76012550 AAGGGATGTAGGAGTTATAGAGG - Intergenic
1099005723 12:77232929-77232951 AAGGAATGAAGGAAGGAAAGAGG - Intergenic
1099474118 12:83087060-83087082 AAGCAGTGGAGCAGTTTAAGAGG - Intronic
1099716544 12:86301116-86301138 TGGGCGTGAATGAGTTAAAGAGG - Intronic
1100174301 12:92011951-92011973 AAGGAGGGAGGGAGGAAAAGAGG + Intronic
1100309254 12:93378546-93378568 AAGGAGTGAGGGAGGAAAGGAGG - Intronic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1100991346 12:100254664-100254686 AAGGAGAGAGGGAGGTAGAGAGG - Intronic
1101009316 12:100432424-100432446 AAGAAGTAGAAGAGTTAAAGGGG - Intergenic
1101430696 12:104624534-104624556 AATGAATGAAGAAGTTAAAAAGG + Intronic
1102657273 12:114492612-114492634 ATAGAGTGTAGGAGTTAAAAGGG - Intergenic
1102992137 12:117322814-117322836 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104410507 12:128553913-128553935 AGGGACTGGAGGAGTAAAAGGGG - Intronic
1104481848 12:129114401-129114423 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104481851 12:129114409-129114431 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1104668784 12:130666740-130666762 AAGGAGGGAAGGAGTGAGGGAGG + Intronic
1105371539 13:19806021-19806043 AAGGAGGGAGGGAGGAAAAGAGG + Intergenic
1105901632 13:24759717-24759739 AGGGAGTGAAGGAATGAGAGAGG + Intergenic
1106960461 13:34991440-34991462 CAGGAGAGAGGGAGTGAAAGGGG + Intronic
1107232886 13:38131772-38131794 AAGAAGTGAAATAGTTAAACTGG - Intergenic
1107387854 13:39931810-39931832 AAGGAGGGAAGGAGGGAGAGGGG + Intergenic
1107401859 13:40077096-40077118 AAGGAGAGAAGGAAGTAAAGAGG + Intergenic
1107401869 13:40077144-40077166 AAGGAGAGAAGGAAGGAAAGAGG + Intergenic
1107917659 13:45168951-45168973 AAGGAGGTAAGGAGGGAAAGAGG - Intronic
1107917661 13:45168959-45168981 AAGGAGGGAAGGAGGTAAGGAGG - Intronic
1107917673 13:45168994-45169016 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1108048382 13:46404857-46404879 AGGGAGGGAAGGAGTGAAAGAGG + Intronic
1108436479 13:50406029-50406051 AAGGAAATAAGGAGTGAAAGAGG - Intronic
1108494389 13:51009308-51009330 TAAGAGTGCAGCAGTTAAAGGGG + Intergenic
1108587119 13:51879908-51879930 AAGGAGAGAAGGAATCAAACAGG + Intergenic
1108613669 13:52109273-52109295 AAGGGGAGGAGGAGTTAATGAGG - Intronic
1108822344 13:54368678-54368700 AAGGAGGGAAGAAGGGAAAGAGG + Intergenic
1109147702 13:58801837-58801859 AAGGAGGGAAGGAAGGAAAGGGG + Intergenic
1109873698 13:68369580-68369602 AAGGGATGAAGGATTCAAAGGGG + Intergenic
1110552906 13:76828024-76828046 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1110562999 13:76929336-76929358 AAGGGGTGAAGGAGGTAGAAGGG + Intergenic
1110696350 13:78495721-78495743 AAGGAGTGACTGAGTTTGAGGGG + Intergenic
1110834333 13:80066508-80066530 AAGGAGGGAAGGAGGGAGAGAGG + Intergenic
1110985725 13:81965661-81965683 AAGGAGGGAAGGAGTGAAGGAGG - Intergenic
1111174165 13:84571637-84571659 AAGGAGAGAAGTAGGGAAAGTGG - Intergenic
1111202004 13:84950323-84950345 AAGGAGAGAAAGAGTGAAAGAGG - Intergenic
1112109994 13:96285914-96285936 AGGGAGGGAAGGAGGGAAAGTGG - Intronic
1112284144 13:98089143-98089165 TTGGAGATAAGGAGTTAAAGAGG - Intergenic
1112311084 13:98318036-98318058 AAGGAAGGAAGGAGATGAAGAGG - Intronic
1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG + Intronic
1112674384 13:101681762-101681784 AAAGAGGGAAGGAGTGAAGGTGG + Intronic
1114369678 14:22072429-22072451 AAGCAGTTAAGGAGGTACAGAGG - Intergenic
1114374116 14:22124416-22124438 AAGGAGAGAAGGAGGAAAATAGG + Intergenic
1115026790 14:28756113-28756135 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
1115026795 14:28756129-28756151 AAAGAGGGAAGGAGGGAAAGAGG + Intergenic
1115356566 14:32454664-32454686 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1115356583 14:32454704-32454726 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1115356586 14:32454712-32454734 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
1115356629 14:32454816-32454838 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1115356658 14:32454888-32454910 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1115356661 14:32454896-32454918 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
1115630167 14:35236990-35237012 AAGGAGTGAAGGAGGGAAGGAGG - Intronic
1116111722 14:40593568-40593590 AAGGAGGGAAAGAGAGAAAGAGG - Intergenic
1116634264 14:47375338-47375360 AAGGAGTGAAGACGTTAAGTGGG - Intronic
1116659585 14:47692081-47692103 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1116805385 14:49489447-49489469 AAGGAGAGAAGGAGGGAAGGAGG + Intergenic
1117570495 14:57044365-57044387 AAGGAGGGAAGGAAGGAAAGAGG + Intergenic
1117571132 14:57050223-57050245 AATGAGTGAAGGAGTAGTAGTGG - Intergenic
1117918318 14:60701728-60701750 AAAGAGTGAAGGAAGGAAAGAGG - Intergenic
1118305993 14:64655809-64655831 AAAGAGATAAAGAGTTAAAGGGG - Intergenic
1118335775 14:64852473-64852495 ATGGAGTGATGGATTCAAAGGGG + Intronic
1118600286 14:67467246-67467268 AAGGAGTTGATGAGTTAAACAGG + Intronic
1118684781 14:68280616-68280638 AAGGAGTGAAGGAGGAAGAGAGG - Intronic
1119428153 14:74549458-74549480 CAGGAGGTAAGGAGATAAAGAGG + Intronic
1119675626 14:76551442-76551464 AAGGAATGAATGAGTGAATGGGG + Intergenic
1119762038 14:77158397-77158419 AGGGAGTGAAGGAGTGAGAGAGG + Intronic
1120057515 14:79942249-79942271 AGGGAGTGAAGGAGTTTGAGTGG + Intergenic
1120433981 14:84456701-84456723 AGGGAGTGAGGGAGGGAAAGTGG + Intergenic
1120437044 14:84495054-84495076 ACAGAGTGCAGGAGTTAAGGAGG + Intergenic
1120739690 14:88094197-88094219 AAGGAGGGAAAGACTTAAAATGG + Intergenic
1120966901 14:90175545-90175567 TAGGTGTGAGGGACTTAAAGGGG - Intronic
1122373403 14:101242169-101242191 AAGGAGAGAAGGAGAGACAGAGG + Intergenic
1122874102 14:104655274-104655296 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1122874105 14:104655282-104655304 AAGGAGGGAAGGAGGGAAGGTGG + Intergenic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1202873505 14_GL000225v1_random:187570-187592 AAAAAATGAAGCAGTTAAAGAGG + Intergenic
1124172398 15:27387901-27387923 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124172409 15:27387929-27387951 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1124384420 15:29194803-29194825 CATGAGTGAAGGCGTTCAAGGGG + Intronic
1124512304 15:30337603-30337625 GACGTGTGAAGTAGTTAAAGTGG + Intergenic
1124730610 15:32193148-32193170 GACGTGTGAAGTAGTTAAAGTGG - Intergenic
1124788994 15:32708993-32709015 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1124850727 15:33336503-33336525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850730 15:33336511-33336533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850733 15:33336519-33336541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124850736 15:33336527-33336549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1124991642 15:34680221-34680243 AAGTAGTGAAGGAGAGGAAGAGG + Intergenic
1125294920 15:38192096-38192118 TAGGAGTTAAGCAGGTAAAGGGG - Intergenic
1125445214 15:39747004-39747026 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445217 15:39747012-39747034 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125445220 15:39747020-39747042 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1125638034 15:41205704-41205726 AAGGAGGGAAGGAGAGAAGGAGG + Intronic
1125978257 15:43975260-43975282 AAGGAATGAAAGATGTAAAGAGG + Intronic
1126010783 15:44300189-44300211 AAGGAGGGAAGGAGAGAAAGAGG + Intronic
1126388515 15:48119928-48119950 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
1126444671 15:48728800-48728822 AAGGAATGGTGGAGTTAGAGTGG + Intronic
1126725570 15:51628216-51628238 TAGGAGTGAAAGAGTGAAATAGG - Intergenic
1127062547 15:55201816-55201838 ACTGAGTAAAGGACTTAAAGAGG - Intergenic
1127291243 15:57573422-57573444 AAGGAGAAAAGGAGTGAAGGAGG - Intergenic
1127346299 15:58103845-58103867 AAGGAGAGAAGGAGAAAAAGGGG - Intronic
1127507497 15:59610690-59610712 AAGGAAGGAAGGAGGGAAAGAGG - Intronic
1127507510 15:59610738-59610760 AAGGAGGGAAGGAGGGAGAGAGG - Intronic
1128124668 15:65184030-65184052 AAGGATTGAATGAGGTAACGTGG - Intronic
1129275585 15:74443179-74443201 AAGGAGAGGAGGAGGTAGAGAGG - Intergenic
1129903863 15:79172465-79172487 AAGGAGTGGAGGAGAAAGAGTGG - Intergenic
1130643287 15:85699524-85699546 AAGGAGAAAAGGAGTTGAAGAGG + Intronic
1130847158 15:87758177-87758199 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG + Intergenic
1131315107 15:91328989-91329011 AAGGAGTGAAAAGGGTAAAGGGG - Intergenic
1132169929 15:99640508-99640530 AGGGAGTGAAGGAGGGAGAGAGG - Intronic
1132719165 16:1307493-1307515 AGGGAGTGAATGAGTGAAGGAGG + Intergenic
1133402662 16:5500117-5500139 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133402665 16:5500125-5500147 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1133506371 16:6416434-6416456 AGGGAGGGAAGGAATTAGAGGGG - Intronic
1133711727 16:8408158-8408180 AAGGAGAGAAGGAATGAAGGAGG - Intergenic
1134286784 16:12868630-12868652 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1134321977 16:13172064-13172086 GAGGAGGGAAGGAGGGAAAGGGG - Intronic
1134449358 16:14354110-14354132 GAGGAGGGAAGGAGGAAAAGAGG + Intergenic
1134603604 16:15552499-15552521 AAGGAGTGAAGGATGTGCAGAGG + Intronic
1134626712 16:15727581-15727603 AAGTAGTGAAAGGGTCAAAGGGG - Intronic
1135206300 16:20487240-20487262 AAGAAGAGAAGGAAGTAAAGAGG + Exonic
1135528446 16:23232079-23232101 AAGGAGTAAAAGAGTCAATGTGG - Intergenic
1135887705 16:26326496-26326518 AAGGAGGGAAGGAGGAAAGGAGG + Intergenic
1135927714 16:26709910-26709932 AAGGAGTGAAGGAAGGAAGGAGG + Intergenic
1136178551 16:28535246-28535268 AAGGAGGGAAGGAGGAAAGGAGG - Intronic
1136589023 16:31206107-31206129 AAGGAAGGAAGGAAATAAAGAGG - Intergenic
1136597603 16:31262302-31262324 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1137521990 16:49202344-49202366 AAGTGGTGAAGGAGTTAAAATGG + Intergenic
1137631911 16:49952528-49952550 AAGGAGTGAAGTTGTTAGTGCGG - Intergenic
1137758791 16:50923955-50923977 AAGAAGGGAAGGAGAAAAAGAGG + Intergenic
1137801025 16:51262163-51262185 AAGGAGGGAAGGAGGGAAGGGGG - Intergenic
1138389752 16:56661807-56661829 AAGGAATGAATGATTTAAAGAGG - Intronic
1138391700 16:56675297-56675319 AAGGAATTAATGATTTAAAGAGG + Intronic
1138697769 16:58831786-58831808 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697772 16:58831794-58831816 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697775 16:58831802-58831824 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697778 16:58831810-58831832 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697781 16:58831818-58831840 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697784 16:58831826-58831848 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697787 16:58831834-58831856 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697790 16:58831842-58831864 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138697793 16:58831850-58831872 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1138957275 16:61986344-61986366 AAGGAGTGAAGGAATTGCACAGG - Intronic
1139278528 16:65750036-65750058 AAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1140636403 16:76920001-76920023 ATGGAGTGAAGGAGAAAGAGAGG + Intergenic
1140929055 16:79610212-79610234 TAGGAGAGAAGGAGAGAAAGAGG - Intergenic
1141090848 16:81129364-81129386 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1141397649 16:83719072-83719094 AAGGAGAGAATGATTTTAAGAGG - Intronic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1141907186 16:87034704-87034726 AAGCAGAGAAAGGGTTAAAGTGG - Intergenic
1142320615 16:89380420-89380442 TAGGAGAAAAGGAGTTAAAATGG - Intronic
1142917892 17:3157642-3157664 ATGGAGTGAAAGACTTAAATAGG + Intergenic
1143737356 17:8922134-8922156 AAGGAGGGAAGGAGGGAAGGTGG + Intronic
1143868709 17:9942700-9942722 AAGGAGTGAAGGAGTCTGCGGGG + Intronic
1144713895 17:17421078-17421100 AAGGAGTGAAGGTGTAGAGGAGG + Intergenic
1145947675 17:28789499-28789521 AAAGAGAGAAGAAATTAAAGAGG - Intronic
1146172727 17:30645996-30646018 AAGGGGTGAAGGACTAAGAGAGG + Intergenic
1146454063 17:32995766-32995788 AAGGAGAGAGGGAGGGAAAGAGG - Intronic
1146902213 17:36596045-36596067 AAGGAGTGAGGGAGGTTAGGAGG + Intronic
1147198711 17:38785045-38785067 AAAGAGTGCCTGAGTTAAAGAGG + Intronic
1147383741 17:40070298-40070320 AAGGAGAGGAGGAGTGAAGGCGG - Intronic
1147456123 17:40539247-40539269 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
1147869589 17:43578112-43578134 AAGGAGTGAGGAAGTGACAGAGG + Intronic
1148231943 17:45941631-45941653 AAGGGGGGAAGGAGGGAAAGAGG - Intronic
1148391496 17:47276142-47276164 AAGGAGGGAAGGAGGAAAAGGGG - Intronic
1149467303 17:56890366-56890388 AGGGAGGGAAAGAGCTAAAGAGG - Exonic
1149749332 17:59129926-59129948 AAGGAAGGAAGGAGAGAAAGAGG + Intronic
1150042721 17:61880783-61880805 AAGGGGGAAAGGAGTAAAAGGGG + Intronic
1150547758 17:66178958-66178980 AAGGTGTGAAGGACTTACACTGG - Intronic
1151956581 17:77383161-77383183 AAGGAGGGAGGGAGAGAAAGAGG - Intronic
1152045982 17:77936006-77936028 AAGGAGAGAAGGAAACAAAGGGG + Intergenic
1152123707 17:78433966-78433988 AGGGAGGGAAGGAGGGAAAGAGG + Intronic
1152652963 17:81504543-81504565 AAGGAGGGAAGGAGAGAAGGAGG + Intergenic
1153625931 18:7022556-7022578 AAGGAGTGAAAGAACAAAAGTGG - Intronic
1154154728 18:11934964-11934986 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1155188785 18:23411153-23411175 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1155213245 18:23620509-23620531 AATGTGTGAAGGAGCTAGAGAGG + Intronic
1155741754 18:29297852-29297874 CAGGAGTCAAGGAGTGAAAGTGG - Intergenic
1155853580 18:30803241-30803263 GAGGAGTGAGGGAGAGAAAGAGG + Intergenic
1156655849 18:39285105-39285127 AAGAAGAGAAGGAGTCAAAAAGG + Intergenic
1157175667 18:45449687-45449709 AAGAAGAGAAGGAGTTGATGGGG + Intronic
1157298414 18:46462329-46462351 AAGCTGTGAAGGAGGGAAAGGGG - Exonic
1158827610 18:61241221-61241243 TTGTAATGAAGGAGTTAAAGAGG - Intergenic
1159093393 18:63874165-63874187 AAGGAGGGAAGGAGGAAAGGAGG - Intronic
1159723590 18:71924563-71924585 ATGGAGTGGAGGGGTAAAAGTGG - Intergenic
1159776846 18:72612492-72612514 AAGGAGGGAGGGAGGTAAGGGGG - Intronic
1159831073 18:73278891-73278913 AAGCAGTGAAGGAGGAAGAGAGG + Intergenic
1159850962 18:73526897-73526919 AAGGGGAGAAGGAGAAAAAGAGG - Intergenic
1160888178 19:1362036-1362058 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1161845589 19:6710195-6710217 AAAGAGAGAAGGAGAGAAAGAGG + Intronic
1161920001 19:7258981-7259003 AAGGAGTGAAGGAAGGAAGGAGG - Intronic
1161963203 19:7534148-7534170 TAGGAGTGAATAATTTAAAGGGG + Exonic
1162215064 19:9127363-9127385 AAGGAAGGAAGGAGAAAAAGAGG - Intergenic
1162697362 19:12486467-12486489 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697365 19:12486475-12486497 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697368 19:12486483-12486505 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1162697371 19:12486491-12486513 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1163189358 19:15665100-15665122 AAGGAGAGGAGGAGTAAAATAGG + Intergenic
1163523697 19:17807618-17807640 AAGGGGTGGAGGAGTTAAGTGGG + Intronic
1163689527 19:18730962-18730984 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1164230913 19:23287467-23287489 AATGAGTGAAAAAGGTAAAGAGG + Intergenic
1164423023 19:28113937-28113959 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1164788030 19:30952251-30952273 AAGGAAGGAAGGAGCAAAAGAGG - Intergenic
1164788038 19:30952294-30952316 AAGGAAGGAAGGAGCAAAAGAGG - Intergenic
1164788046 19:30952337-30952359 AAGGAAGGAAGGAGCAAAAGAGG - Intergenic
1165289002 19:34868056-34868078 AAGGAGTGAGAGAGTGAAGGGGG + Intergenic
1165691625 19:37868239-37868261 AAGGGGTGAAGGAATCAAAAAGG + Intergenic
1166201037 19:41238229-41238251 GAGGGGTAAAGGAGTGAAAGGGG - Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167207018 19:48109587-48109609 AAGGGGTGACTAAGTTAAAGTGG + Intronic
1167282218 19:48576163-48576185 AAGGAGGGGAGGAGGAAAAGTGG + Intronic
1168220365 19:54956141-54956163 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1168462098 19:56567790-56567812 AATGAGTGAAGCACTTTAAGTGG + Exonic
925159821 2:1676193-1676215 AAGGAGTGATGGAGTCTAGGGGG - Intronic
926236466 2:11048961-11048983 AAGGGGAGAAGAAGTAAAAGGGG - Intergenic
927010149 2:18895709-18895731 AAAGAATGAAAGAATTAAAGTGG - Intergenic
927877819 2:26670532-26670554 AAGGAGGGAAGGAGGGAGAGAGG + Intergenic
928335514 2:30394769-30394791 AAGGAGGCAAAGAGTAAAAGAGG - Intergenic
928431701 2:31224436-31224458 AAGGGGTGAAGAAGTTGAGGTGG + Intronic
928986912 2:37191001-37191023 AAGGAATGAAGGGGTAAGAGGGG + Intronic
929660084 2:43775244-43775266 AAGGAATGAAGGATTTAAAGAGG + Intronic
929914372 2:46121963-46121985 AAGGAGGGAAGGAGGGAAAAAGG - Intronic
930209811 2:48623903-48623925 AAGGAGAGAAGGAGAGAAGGGGG + Intronic
930752194 2:54945032-54945054 GAGGAGGGAAGGAGTGAAGGAGG - Intronic
931832481 2:66067121-66067143 AAGGAATGAAGGGGATAAAGTGG - Intergenic
932134216 2:69214249-69214271 AAGGAGAGAAACAGTTACAGAGG - Intronic
932955268 2:76344421-76344443 TAGGAGAGAAGGAGCTAAGGGGG + Intergenic
933031974 2:77339783-77339805 GAGGAGTGAAGGGGAAAAAGGGG + Intronic
935415845 2:102817903-102817925 ATTGAGTGAAACAGTTAAAGTGG - Intronic
935420820 2:102867001-102867023 AAGGACAGAAGGAGGCAAAGAGG + Intergenic
936384075 2:112013038-112013060 AAGAAGAGAAAGAGTAAAAGGGG - Intronic
936399050 2:112152017-112152039 AACGAGTGAACGAGTGAATGAGG - Intronic
936416707 2:112322116-112322138 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936416710 2:112322124-112322146 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
936496555 2:113027263-113027285 AAGAGGTGGAGGAGTTAGAGGGG + Intronic
936778338 2:116001285-116001307 AGGGAGGGAAGGAGGAAAAGAGG + Intergenic
937372431 2:121309325-121309347 AAGGAGGGAGGGAGGCAAAGAGG + Intergenic
937615841 2:123921389-123921411 AAGGAATGAAGGAGGGAAGGAGG + Intergenic
937615844 2:123921397-123921419 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
937788311 2:125928577-125928599 AAGAAGGCAAGAAGTTAAAGGGG + Intergenic
938782153 2:134594217-134594239 AAAGAGTGAAGGAGAGACAGGGG + Intronic
939081186 2:137663655-137663677 ATGGAGGGAAGGAGGAAAAGAGG + Intronic
939280475 2:140057922-140057944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
939875046 2:147568287-147568309 ATGGAGGGAAGGAGGGAAAGAGG + Intergenic
939926700 2:148183983-148184005 AAGGAATGATGGAGTTGAACAGG - Intronic
940120987 2:150265484-150265506 AAAGAGTGAAGCATGTAAAGGGG + Intergenic
940159573 2:150696913-150696935 AAGGAAGGAAGGAGGGAAAGAGG + Intergenic
940787698 2:157999946-157999968 AAGGAGGGAAGGAGAGAGAGAGG + Intronic
941201225 2:162513270-162513292 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
941508393 2:166376008-166376030 GAGGAGTGGAGGAGGCAAAGCGG - Intergenic
941591897 2:167430300-167430322 ATGAAGTCAAGGAGTTAATGAGG + Intergenic
941633298 2:167908014-167908036 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
941865828 2:170333346-170333368 ATGGAGTGAATGAGATAAAGAGG + Intronic
942183394 2:173402143-173402165 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
942655304 2:178208749-178208771 AAGGACAGAAGGAGGGAAAGAGG - Intronic
942768213 2:179482804-179482826 AAGGAGTTGAGGAGCCAAAGGGG - Intronic
942902386 2:181137281-181137303 AAAGAGTAAAGGAGAGAAAGAGG - Intergenic
943860627 2:192857754-192857776 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
944001610 2:194845297-194845319 AAGGAGAGAAGGAGAGAAAGAGG + Intergenic
944007853 2:194932877-194932899 TAGGAATGCTGGAGTTAAAGAGG - Intergenic
944126203 2:196295598-196295620 GAGCAGTGAAGGCGATAAAGAGG - Intronic
944530128 2:200659462-200659484 CAGGAGTGAGGGAGAAAAAGAGG - Intronic
944775574 2:202960758-202960780 AAGGAGGGAAGGAGAGAAGGAGG - Intronic
944959391 2:204853891-204853913 AAAAAGTAAAGGAGTTAGAGAGG + Intronic
945728577 2:213504259-213504281 AAGGAATGAAGAAGTGAAAGTGG + Intronic
946014443 2:216592735-216592757 AGGGAGGGAAGCAGGTAAAGAGG - Intergenic
946642367 2:221798249-221798271 AAAGAATGAAGGAGAGAAAGAGG - Intergenic
947133576 2:226954834-226954856 AAGAAGAGAAGGAGTGAAGGGGG + Intronic
947237257 2:227953940-227953962 AAGGAGTGAGGAATTTATAGAGG - Intergenic
947445559 2:230160247-230160269 AAGTAGTGAAGGCTTTGAAGGGG - Intergenic
948035146 2:234852398-234852420 AAATGGTGATGGAGTTAAAGAGG + Intergenic
948190327 2:236053271-236053293 AACGAGTAAATGAGTGAAAGCGG + Intronic
1168744079 20:221360-221382 AAGGAGGGAAGGAGTGAGGGAGG + Intergenic
1169598422 20:7227455-7227477 AAAGAGAAAGGGAGTTAAAGAGG + Intergenic
1169679863 20:8198892-8198914 AAAGTGTGAAGGAGAGAAAGAGG + Intronic
1169766738 20:9154888-9154910 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1170501793 20:16982363-16982385 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
1170633918 20:18088472-18088494 AAGGAGGGAAGGAGAGAAGGAGG - Intergenic
1170841951 20:19930784-19930806 AAGGAGTGAAGGGACTAAAAAGG - Intronic
1170880944 20:20296146-20296168 AAGGAATGAAGGAGGGAAGGAGG - Intronic
1170915005 20:20614094-20614116 AAGGAGTGAAGAAGGAAAGGAGG + Intronic
1171433668 20:25103484-25103506 GAGAAGTGTAAGAGTTAAAGAGG - Intergenic
1171756444 20:29113964-29113986 AAGGAATGAAGGAAGGAAAGAGG + Intergenic
1171862482 20:30413237-30413259 AAGGAGGGAAGGAAGGAAAGAGG + Intergenic
1171905820 20:30899263-30899285 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
1171992426 20:31707045-31707067 AATGAGTTAAGTATTTAAAGTGG - Intronic
1172709732 20:36912263-36912285 AAGGAGGGAAGTGGATAAAGGGG - Intronic
1172940341 20:38649724-38649746 AAGGGGTGAAGGAGGTTGAGTGG - Intronic
1173057690 20:39632038-39632060 AATGAATGAAGGAGTTGATGTGG - Intergenic
1174221569 20:48959590-48959612 AAGGAGGGAAGGAGGGAAAGAGG - Intronic
1174583863 20:51592550-51592572 TAGAAGAGAAGGAGTGAAAGGGG + Intergenic
1174696930 20:52569254-52569276 AAGGAAAGAAAGAGATAAAGTGG - Intergenic
1174795844 20:53522033-53522055 AAGGAGAGAAGGAGGGAAGGAGG + Intergenic
1174795847 20:53522041-53522063 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174795850 20:53522049-53522071 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1174926547 20:54766754-54766776 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926550 20:54766762-54766784 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174926553 20:54766770-54766792 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1174969853 20:55262776-55262798 AAGGATTGAAGGAATTAACCTGG + Intergenic
1176988703 21:15468028-15468050 AAGGAGAAAAGAAGTAAAAGAGG + Intergenic
1177084552 21:16687070-16687092 AAGGATTGAAAAAGTTAAAAAGG + Intergenic
1177085399 21:16696419-16696441 AAGGAGTGAAGACTTAAAAGAGG + Intergenic
1177327376 21:19608617-19608639 AAGAAGAGAAGGAGAGAAAGGGG + Intergenic
1177662386 21:24102221-24102243 AAGGAGGGAAGAAGGGAAAGAGG + Intergenic
1178441447 21:32601875-32601897 ATGGAGTGAAAGACATAAAGTGG - Exonic
1180413495 22:12637823-12637845 AAGGAATGAAGGAAGGAAAGAGG + Intergenic
1181534364 22:23534047-23534069 AAGGAGAGAAGGACGGAAAGAGG + Intergenic
1181662802 22:24365486-24365508 AAGTAGTGAAGAAGTGAAACGGG + Exonic
1182007046 22:26969723-26969745 AAGGAGGGAAGGAGAGAGAGAGG - Intergenic
1182370208 22:29805352-29805374 AAGCAGTGAGGGAGTCTAAGGGG - Intronic
1182774245 22:32819151-32819173 AGGGAGTGAGGTAGTGAAAGAGG + Intronic
1182931428 22:34178166-34178188 AAGCAGGGAAGGAGGTAAGGAGG - Intergenic
1183209736 22:36443425-36443447 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1183237356 22:36629609-36629631 AAGGAGTTAGGCAGGTAAAGGGG + Intronic
1183573366 22:38671040-38671062 AAGGACAGAACCAGTTAAAGGGG - Intronic
1183853982 22:40617159-40617181 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1183853985 22:40617167-40617189 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1185001920 22:48251390-48251412 AAGGAGGGAAGGAGTGAAGGAGG - Intergenic
1185076377 22:48685208-48685230 AAGGAATGCTGGAGTTAAAATGG + Intronic
949508047 3:4744978-4745000 AAGGAGAGAAGGAGGGAAAGAGG - Intronic
949634472 3:5967654-5967676 AAGTAGTGAAGGAAATAGAGAGG - Intergenic
950342899 3:12263272-12263294 AAGGAGTGAGGGAGGGAAAAGGG + Intergenic
950395202 3:12728715-12728737 AAGGCGTGGAGGAATAAAAGAGG - Intergenic
952168179 3:30774886-30774908 AAGCAGAGACGGAGGTAAAGAGG + Intronic
952522915 3:34180170-34180192 AAGGAATGAAAGAATTAAATGGG - Intergenic
952875973 3:37944760-37944782 AAAGAGTGAAGCAGCCAAAGTGG - Intronic
952898221 3:38093320-38093342 AGGGAGGGAAGGAGGAAAAGAGG - Intronic
952960312 3:38585238-38585260 GATGAGTGAATGAGTAAAAGTGG + Intronic
953082305 3:39632148-39632170 AAGGAGGGAAGGAGAGAAGGAGG - Intergenic
953852668 3:46478106-46478128 GAGGAGTGAAAGAGTTACAAAGG - Intronic
954656124 3:52195293-52195315 AAGGAGGGAAGGAGGGAAAAGGG + Intergenic
954680455 3:52343232-52343254 AAGGAGGGAAGGAAGTCAAGGGG + Intronic
954989413 3:54827216-54827238 CACAAGTGAAGGAGTTAAAAAGG - Intronic
956643673 3:71435969-71435991 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
957040957 3:75335201-75335223 AAGGAGAGAAGAAGGTAATGGGG + Intergenic
957120905 3:76090822-76090844 AAGGAGTGAAGGCAATACAGTGG + Intronic
957142798 3:76382903-76382925 AAGGAATTAAGGAAATAAAGAGG + Intronic
957515154 3:81240696-81240718 AAGGAGGGAAGGAGGGAATGAGG + Intergenic
957515166 3:81240732-81240754 AAGGAGGGAAGGAGGGAGAGAGG + Intergenic
959137220 3:102438426-102438448 TAGGAGTGAAGGAGTTAAGTGGG + Intronic
959598676 3:108154890-108154912 AAGGAGTCAAGCAGGAAAAGTGG - Intergenic
959758660 3:109930089-109930111 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
959868014 3:111292962-111292984 AAAGCGTGAAGGTGTGAAAGGGG - Intronic
960891410 3:122452503-122452525 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891413 3:122452511-122452533 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891416 3:122452519-122452541 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
960891419 3:122452527-122452549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
961117444 3:124342883-124342905 CAGGAGTGAATGAGTTATAAGGG - Intronic
961522761 3:127476732-127476754 AAGGAGGGAAGGAGGGAAAGAGG + Intergenic
961790765 3:129375191-129375213 AAGGAATGAAGGGGTGAGAGTGG - Intergenic
962155369 3:132942407-132942429 AACGTGTGAAAGAGATAAAGTGG - Intergenic
962338406 3:134559767-134559789 AGGCAGTGAAGGAGGAAAAGAGG + Intronic
962816360 3:139004898-139004920 AAGGAGTTAAGGAGAGCAAGTGG + Intergenic
963069044 3:141287386-141287408 AAAGAGGCAAGGAGTTCAAGGGG - Exonic
963374465 3:144446216-144446238 AAGGAGTGAAGGTGATAGAGAGG + Intergenic
963759148 3:149268809-149268831 AAGAAGAGAAGGAGGAAAAGAGG - Intergenic
964191470 3:154006694-154006716 AAGCAGAGAAGGAGATAAAAGGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964903847 3:161693962-161693984 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
965083878 3:164069439-164069461 AAGCAGAGAAGGAGGGAAAGAGG + Intergenic
965186901 3:165476518-165476540 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965186953 3:165476684-165476706 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
966045602 3:175544708-175544730 AAGGAGAAAAGGAGTGAAAGAGG - Intronic
966112396 3:176418912-176418934 AAGGGGTGATGAAGTTAAAATGG + Intergenic
966252929 3:177887046-177887068 AAAGAATGAAAGAGCTAAAGGGG + Intergenic
966306964 3:178547158-178547180 GAGAAGTGAAGGAGGAAAAGGGG - Intronic
966441830 3:179953842-179953864 AAGGAGTGAAAGAGCTGAAAAGG + Intronic
966811990 3:183855143-183855165 AAGGAGGGAAGGAGGGAATGGGG + Intronic
966982259 3:185148639-185148661 AACGAGTGAAGGTTTTCAAGAGG - Intronic
967420137 3:189263296-189263318 TAGGAGTTAAGGAGATGAAGGGG + Intronic
967514370 3:190349304-190349326 CAGGAGAGAAGGAGTGAAGGGGG - Intronic
967726737 3:192869307-192869329 AAGGAGGGAAGGAGGGAAAAAGG + Intronic
967789476 3:193531416-193531438 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
968959306 4:3734880-3734902 AAGGAGGGAAGGGCATAAAGTGG + Intergenic
970915007 4:21322083-21322105 AAGGAGGGAAGGAGAAAAAGAGG + Intronic
971218109 4:24680667-24680689 AAGGAGTGAGGGAGGGAAGGAGG + Intergenic
971289823 4:25327397-25327419 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289826 4:25327405-25327427 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971289829 4:25327413-25327435 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
971364339 4:25965591-25965613 AAGGAGTTAAGGGGAAAAAGAGG - Intergenic
971665533 4:29478675-29478697 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
972196971 4:36665451-36665473 AAGGAGTGATGGAGGAAATGAGG - Intergenic
973531287 4:51839116-51839138 AAGGAGAGAAGGAGGGAATGAGG + Intergenic
973544391 4:51966197-51966219 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
974392531 4:61290684-61290706 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
974392534 4:61290692-61290714 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
975208093 4:71667494-71667516 AAGGAGGGAGGGATGTAAAGAGG - Intergenic
975270261 4:72423726-72423748 AAGGATTGAGGAAGGTAAAGTGG + Intronic
975328578 4:73087963-73087985 AAGGAGGGAAGAAGGAAAAGGGG + Intronic
975813148 4:78190542-78190564 AGGGAGAGAAGGAGGAAAAGAGG - Intronic
976006013 4:80431453-80431475 AAGGAGTGAGGGAGGCAAAAAGG - Intronic
976269295 4:83214787-83214809 AATGAGAGAAGGAGCTACAGTGG + Intergenic
976527213 4:86107586-86107608 AAGGGGGGAAGGAGTAGAAGAGG + Intronic
977764759 4:100783879-100783901 AAGAAGTGATGGATTTAAAATGG - Intronic
977779586 4:100965135-100965157 AAGGAGTTAAGTAGGTAAAAAGG + Intergenic
978502000 4:109419724-109419746 AAGGAATGAAGGGGTAAGAGAGG - Intergenic
978977896 4:114901795-114901817 AAGAAGAGAAGGAGTGGAAGGGG - Intronic
979430088 4:120619115-120619137 AATGAGTGAAGGAATGAATGTGG - Intergenic
979538448 4:121851412-121851434 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
979698544 4:123640937-123640959 AAGGAGGGAGGGAGTGAAGGAGG + Intergenic
980001940 4:127499640-127499662 AAGAAGTGAAGGAGAAAGAGAGG + Intergenic
980402026 4:132303043-132303065 ATGGAGTGAAGGAAATAATGTGG - Intergenic
980872982 4:138631463-138631485 AAGGAGGGAAGGAATTAATCTGG - Intergenic
981282289 4:142972187-142972209 AAGGAGAGAAGGAGGGAGAGAGG + Intergenic
981948957 4:150382771-150382793 AAGTAGTGAAGAACTTAAACTGG + Intronic
982294123 4:153808915-153808937 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294126 4:153808923-153808945 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
982294129 4:153808931-153808953 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
983426718 4:167593516-167593538 AGGGAGGGAAGGAGAGAAAGAGG - Intergenic
984224993 4:177023792-177023814 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
984863168 4:184257547-184257569 AAGGAGGGAAGGAGTGGGAGTGG + Intergenic
985870674 5:2553049-2553071 AGGGAGTGAAGGAATAAATGAGG - Intergenic
986601046 5:9473612-9473634 AAGGAGGGAAGGAGCTGAAGAGG + Intronic
986755214 5:10829468-10829490 CAGCAGTGAAGGTGATAAAGGGG - Intergenic
986767161 5:10938656-10938678 AAGTAATGAAGGAGCTAAACTGG + Intergenic
986806825 5:11315211-11315233 AAAGAGTGGAGCAGTTAAAGGGG + Intronic
986830568 5:11572589-11572611 GAGGAGGGAAGAAGTTGAAGTGG - Intronic
987370112 5:17185514-17185536 AAGGAGAGAGGGAGGGAAAGAGG - Intronic
987691123 5:21268377-21268399 AAGGAGTTAAGTAGTCACAGAGG - Intergenic
987960173 5:24796941-24796963 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
988166782 5:27601786-27601808 AAGCAGAAAAGTAGTTAAAGAGG + Intergenic
988418312 5:30974452-30974474 GAGGAGGGAAGGAGTTGCAGAGG - Intergenic
989060161 5:37402915-37402937 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
989580882 5:43032582-43032604 AAGGAGGTAAGGAGATAAGGGGG + Intergenic
989601302 5:43203110-43203132 AAGTAGTGAAGGAGCTATGGCGG - Intronic
990040480 5:51373193-51373215 AAGGAAAGAAGGAGTTGAAAAGG - Intergenic
990232720 5:53731524-53731546 AAGGAGAGAGGGAGTGAAGGAGG + Intergenic
992302832 5:75402202-75402224 AAGTAGTGAAGGTAATAAAGGGG + Intronic
992530049 5:77644958-77644980 AGGGAGGGAAGGAGAAAAAGGGG - Intergenic
992606545 5:78463021-78463043 AAGTACTGAAAGAGTAAAAGTGG - Intronic
992865889 5:80956854-80956876 AGGGAGGGAAGGAGGGAAAGAGG - Intergenic
992898537 5:81269786-81269808 AAGGTGTGAAAGTGTGAAAGGGG + Intergenic
993408856 5:87549140-87549162 AAGGTCTGAAGGAGGTAAATAGG - Intergenic
993698528 5:91091342-91091364 AAAGAGTGAAGGAGATAGTGGGG + Intronic
993762846 5:91818285-91818307 ATGGAGGTAAGGAGGTAAAGAGG + Intergenic
993875818 5:93305497-93305519 AAGGAAGGAAGGAGAAAAAGAGG + Intergenic
993994675 5:94708729-94708751 AAGAAATGAAGGAGAAAAAGAGG - Intronic
994439356 5:99783239-99783261 AAGGAGGGAAGGAGAGAGAGAGG - Intergenic
994596416 5:101843267-101843289 AAGGAGGGAAGGAGGAAAGGGGG + Intergenic
994608930 5:102010967-102010989 AATGAGTGAAGGAGTTACCATGG - Intergenic
994909616 5:105885883-105885905 ATGGAGTGCAGGAGTCAAATAGG - Intergenic
994918986 5:106017701-106017723 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
994972638 5:106761245-106761267 AAGGAGAAAAGAAGTAAAAGAGG - Intergenic
995304570 5:110630558-110630580 AAGGAGAGAGAGAGTGAAAGGGG - Intronic
995654205 5:114406363-114406385 GAGGAGTGAAGTTGTGAAAGGGG - Intronic
995775012 5:115715801-115715823 AAGGAGTCCAGGAGTTAGGGAGG + Intergenic
995996325 5:118304830-118304852 AAGGAGGGAAGGAGGGGAAGAGG + Intergenic
996176475 5:120365773-120365795 TAGGAATGAGTGAGTTAAAGTGG + Intergenic
996218495 5:120898062-120898084 AAGGAAGGAAGGAGTAAAAAAGG - Intergenic
996826814 5:127692080-127692102 CAGGAGTCAAGGAGTAAAGGAGG - Intergenic
996942703 5:129027875-129027897 AAGCATTAAAGGAGTCAAAGGGG + Intronic
997174521 5:131760879-131760901 AAGGAGGGAAGGAAGGAAAGAGG + Intronic
997413535 5:133708076-133708098 AAAGAGGGAAGGAGGGAAAGGGG + Intergenic
997538678 5:134642904-134642926 AAGGAGTGTGGAAGTCAAAGAGG + Intronic
997576331 5:134980381-134980403 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
998033892 5:138896886-138896908 AAGGAATGAAGCAATTAAAAAGG - Intronic
999703776 5:154252608-154252630 AAGGAATGAAGGAGAAAAGGAGG - Intronic
1000194296 5:158942968-158942990 AAGGAGGGAAGGAGGAAGAGAGG + Intronic
1000290356 5:159864382-159864404 AAGGAGTCAAGGAGTCACAGAGG - Intergenic
1000428054 5:161115986-161116008 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1000428086 5:161116111-161116133 AAGGAGGGAAGGAGGGAGAGAGG + Intergenic
1000835558 5:166149586-166149608 AGTGAATGAAGGAGATAAAGAGG - Intergenic
1000924868 5:167180884-167180906 AAGGGGTGGAGGAGGTAAAAGGG + Intergenic
1002559668 5:180072572-180072594 AGGGACTGAGGGAGTTGAAGTGG + Intergenic
1002569373 5:180131340-180131362 AGGGTGGGAAGGAGTCAAAGGGG - Intronic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1003366001 6:5475640-5475662 CAGGAGTGAGGGAAGTAAAGAGG - Intronic
1003373726 6:5554137-5554159 AAGGAAGGAAGGAGTTTCAGCGG - Intronic
1003477932 6:6501991-6502013 AAGGAGGGAGGGAGAAAAAGAGG + Intergenic
1003679909 6:8242785-8242807 AAGCAGAGAAGAAGTTGAAGTGG - Intergenic
1004053818 6:12114175-12114197 AAGGAGTGAAGGAGGGCATGAGG - Intronic
1004068728 6:12276848-12276870 AATGGGTCAAGGATTTAAAGTGG + Intergenic
1004638652 6:17492761-17492783 AAGGAGTGAAGCAGTACAAAGGG - Intronic
1005441895 6:25878951-25878973 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1005570302 6:27139124-27139146 AAGGACTGAAGGAGAACAAGAGG + Exonic
1006391811 6:33763047-33763069 AAGGAGGGAAGGGGATAATGGGG + Intergenic
1007082317 6:39116467-39116489 AAGGAGGGAAGGAGGGAGAGAGG + Intergenic
1007111451 6:39315405-39315427 AGGGAGTGATGAAGTTAAGGGGG + Exonic
1007124925 6:39417995-39418017 AAGGGGAGAAGGAGGGAAAGAGG - Intronic
1007407512 6:41643527-41643549 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1007730333 6:43941573-43941595 CTGGAGTGAAGGAGGCAAAGGGG + Intergenic
1008402989 6:51085682-51085704 AAAGACTGAAGGATTAAAAGGGG - Intergenic
1008497951 6:52152118-52152140 AGGGAGGGAAGGAGTGAGAGAGG + Intergenic
1008606972 6:53150042-53150064 AAGGCGTGAAGGACTGGAAGAGG + Intergenic
1008698968 6:54075999-54076021 AAAGCATGAAGGAGTTAAATTGG + Intronic
1009761552 6:68013064-68013086 AAGGAAGGAAGGAGAGAAAGAGG + Intergenic
1009828887 6:68904044-68904066 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1009828890 6:68904052-68904074 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1010402162 6:75458408-75458430 AAGGTCTAGAGGAGTTAAAGTGG + Intronic
1011154373 6:84313748-84313770 AAGGAGGGAAGGAGGAGAAGAGG - Intergenic
1011207090 6:84911498-84911520 AAGGAATGAATGAGTGTAAGAGG - Intergenic
1011614727 6:89187054-89187076 GAGGAGTGTAGGAGTCACAGGGG + Intronic
1012260345 6:97081161-97081183 AAGGAGTGAGGGGGGAAAAGTGG + Intronic
1013358875 6:109374708-109374730 AAGGTGAGAAGGAGTTAAGCTGG - Intronic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1013647659 6:112161496-112161518 ATGGAATGAATGAGTAAAAGTGG - Intronic
1013677332 6:112480226-112480248 AAGGAGGGAAGGAGGAAAGGAGG - Intergenic
1013677352 6:112480282-112480304 AAGGAGGGAAGGAGGAAAGGAGG - Intergenic
1013957967 6:115862158-115862180 AAGGCATTAAGGAGTTGAAGAGG - Intergenic
1013976551 6:116085360-116085382 AATGTGTGAAGTAGTGAAAGGGG + Intergenic
1014567851 6:122972652-122972674 AAGCTATGAAGGAGATAAAGGGG + Intergenic
1015344924 6:132145084-132145106 AAAGACTGAAGGAGAGAAAGGGG - Intergenic
1015383906 6:132600774-132600796 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383953 6:132600922-132600944 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015383962 6:132600954-132600976 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1015808988 6:137142491-137142513 AAGGAGAGAGGGAGTAAAATTGG - Intergenic
1016091587 6:139985709-139985731 AAGGAGGGAAGGAAGGAAAGAGG - Intergenic
1017024298 6:150167963-150167985 GAGGAGAGAAGGAGAGAAAGAGG - Intronic
1017041047 6:150308959-150308981 AAGGAGGGAGGGAGGAAAAGAGG + Intergenic
1017178360 6:151526144-151526166 AAGGAGGGAAGGAGGGAGAGAGG - Intronic
1017680886 6:156862669-156862691 AAGGAGTGAATGAGGAAAGGAGG + Intronic
1018914047 6:168121876-168121898 CAGGAGGGAAGGAGAGAAAGAGG + Intergenic
1019377526 7:701210-701232 AAGGAGAGAAGGAGGGAAGGAGG + Intronic
1019730587 7:2627413-2627435 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1020240399 7:6390018-6390040 AAGGAGGGAAGGAGTAGGAGAGG - Intronic
1020677502 7:11198673-11198695 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1021013584 7:15503084-15503106 AATGAATGAATGACTTAAAGTGG - Intronic
1021295917 7:18905940-18905962 AAGGAATGAAGGAAAGAAAGAGG - Intronic
1021300283 7:18964268-18964290 TAGGAGTTAAGTAGTCAAAGAGG - Intronic
1021855184 7:24848172-24848194 AAGGAGTGAAGGTGTGTGAGGGG + Intronic
1022391658 7:29949361-29949383 AAAGAGTGAAGGAAAGAAAGGGG - Intronic
1023397401 7:39763873-39763895 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1023848151 7:44134829-44134851 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1024281502 7:47723024-47723046 AAGGATTGAATGAGTTGATGTGG + Intronic
1025888899 7:65627054-65627076 ATAGAGTGGAGGAGTTGAAGAGG + Intergenic
1026650016 7:72209009-72209031 AAGGAGGGAAGGAAGGAAAGAGG - Intronic
1026650039 7:72209134-72209156 AAGGGGGGAAGGAATGAAAGAGG - Intronic
1026769672 7:73187521-73187543 AAGGAGGGAAAGAGAGAAAGAGG - Intergenic
1027010541 7:74740907-74740929 AAGGAGGGAAAGAGAGAAAGAGG - Intronic
1027077501 7:75205137-75205159 AAGGAGGGAAAGAGAGAAAGAGG + Intergenic
1027416879 7:77983400-77983422 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1028044035 7:86092914-86092936 CATGAATCAAGGAGTTAAAGTGG + Intergenic
1028064195 7:86361071-86361093 AAGGAGGGAACAAGGTAAAGAGG + Intergenic
1028529755 7:91825308-91825330 AAAGTGTGAAGGTGTGAAAGGGG - Intronic
1028636755 7:92997877-92997899 AAGGAGTGAAGGAGGGAAGGAGG - Intergenic
1028636758 7:92997885-92997907 AAGGAGGCAAGGAGTGAAGGAGG - Intergenic
1028636783 7:92997986-92998008 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1029088266 7:98028297-98028319 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1029412778 7:100426648-100426670 AAGGAGTAAAGGAGGGAGAGAGG - Intronic
1029469330 7:100744247-100744269 CAGGAGTGCAGGAGTCCAAGTGG - Intronic
1029477730 7:100794936-100794958 AAGGAGGGAAGGAGAGAAGGAGG + Intronic
1029931928 7:104381547-104381569 AGGGAGTGAGGGAGGGAAAGAGG - Intronic
1030942492 7:115671304-115671326 AAGGAGGGAAGGAGGGAGAGAGG - Intergenic
1031630169 7:124034306-124034328 AAGGAAGGAAGGAGATAAAGAGG - Intergenic
1031853550 7:126894914-126894936 ATAGAGTGGAGGAGTTGAAGAGG - Intronic
1031993016 7:128210146-128210168 AAGGAGAGAAGGAGAGAAGGAGG + Intergenic
1034520720 7:151617265-151617287 AAGGAGGGAGGGAGGGAAAGAGG + Intronic
1035043318 7:155946710-155946732 AAGGAATGAAGGAAGGAAAGAGG - Intergenic
1036285433 8:7441031-7441053 AAGCAGTGAAGGAGAGAACGAGG + Intergenic
1036336041 8:7870498-7870520 AAGCAGTGAAGGAGAGAAGGAGG - Intergenic
1037268398 8:17095742-17095764 AAGGAAAGAAGGAAATAAAGAGG - Intronic
1037344433 8:17883914-17883936 AAGGAGGGAAGGAGAAAGAGAGG - Intronic
1037691227 8:21183239-21183261 AAGGAGAGGAGGAGGAAAAGGGG - Intergenic
1037774405 8:21823398-21823420 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1037774408 8:21823406-21823428 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
1038232481 8:25714987-25715009 AAGGAGTGAGGGAGGGAAAAAGG - Intergenic
1038899856 8:31830362-31830384 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1038899859 8:31830370-31830392 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1039003594 8:33008956-33008978 AAGGAGTGAAGGAGACAGATGGG + Intergenic
1039203499 8:35123272-35123294 AAGGAACAAAGGAGTGAAAGGGG + Intergenic
1040662151 8:49585743-49585765 AAGAAGTGAAGGAACAAAAGTGG + Intergenic
1041093089 8:54322001-54322023 AAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1041558055 8:59181755-59181777 ATGGAATGAAGGAGTGAGAGAGG + Intergenic
1041829303 8:62134812-62134834 TAGGAGAGAAGGAGTGAAATAGG - Intergenic
1042050068 8:64694154-64694176 CAGGAATGAAGCAATTAAAGGGG - Intronic
1042774182 8:72411398-72411420 AAGTAATAAAGGAGTTAAAATGG - Intergenic
1042865047 8:73349537-73349559 AAAGAATGAAGGAGTGAATGGGG - Intergenic
1044443564 8:92247776-92247798 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1044501395 8:92962881-92962903 AAAGAGAGTAGGAGTAAAAGGGG + Intronic
1044554248 8:93544843-93544865 AAGGCATGAAGAAGTTAAACTGG + Intergenic
1045357924 8:101405743-101405765 AAGGAGTGAAGGAGGGAAGAGGG - Intergenic
1045602412 8:103732874-103732896 AAGGAGTGAAGGCTTGGAAGTGG + Intronic
1046072972 8:109281466-109281488 AAGGAAAGAAGGAGTGAAAGAGG - Intronic
1046122700 8:109865543-109865565 AAGGAGGGAGGGAAATAAAGAGG - Intergenic
1046288083 8:112121457-112121479 AAGGTGTGAAGTAGGTAAACAGG + Intergenic
1046501676 8:115085796-115085818 AAGGAGTGTAGAATTTTAAGTGG - Intergenic
1046754674 8:117961121-117961143 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1047060926 8:121224476-121224498 AAGGCGTGTAGAAGTTTAAGAGG - Intergenic
1047228994 8:122980024-122980046 AGGAAGAGAAGGAGTTCAAGAGG - Intergenic
1047531771 8:125683444-125683466 AAAGAGAGGAGGAGTTAATGTGG - Intergenic
1048074447 8:131053894-131053916 AAGGAAGGAAGGAGGGAAAGAGG - Intergenic
1048161859 8:132028596-132028618 AAGGAGGGAAGGAGGGAAGGAGG + Intronic
1049499009 8:142951403-142951425 AAGGAGATAAGGAATCAAAGGGG - Intergenic
1049533856 8:143169073-143169095 AAGCTGAGAAGGAGTTAGAGGGG - Intergenic
1049978573 9:883078-883100 AAAGAGTGAAAGAGTGAAAAGGG - Intronic
1050571125 9:6940046-6940068 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1050573530 9:6967567-6967589 AAGGACTGGAGGAGTGAAACGGG + Intronic
1050825456 9:9939908-9939930 AAGAAATGAAGGTGATAAAGTGG - Intronic
1050930980 9:11326296-11326318 AAGGAATGAAGAGGTGAAAGTGG - Intergenic
1051014952 9:12463156-12463178 AAGGAGAGAAGGAGGGAGAGAGG - Intergenic
1051762092 9:20478829-20478851 AAGGAGAGAAGGAGAGGAAGGGG + Intronic
1051798273 9:20900890-20900912 TAGGAGAGAAGGAGGGAAAGAGG + Intronic
1052027452 9:23589409-23589431 AAGGAATGAAGGAAATCAAGTGG + Intergenic
1055507893 9:76966555-76966577 AATGAGTGAAGTACTTTAAGTGG - Intergenic
1055730269 9:79273793-79273815 AAAGAGAGAAGGAGAGAAAGAGG + Intergenic
1056160621 9:83888307-83888329 AAGGAGTAAAAGAGTAAAAGAGG + Intronic
1056203174 9:84295971-84295993 AAAGCTTGAGGGAGTTAAAGAGG + Intronic
1056325963 9:85479306-85479328 AAGGAGGGAAGGAGGGAGAGAGG - Intergenic
1056488430 9:87082265-87082287 AATGAGTGAAGAAGTGAATGTGG - Intergenic
1057181591 9:93033526-93033548 GAGGAGTGGAGGAGGAAAAGAGG - Intronic
1057226068 9:93293844-93293866 AGGGAGAGAAGGAATGAAAGGGG - Intronic
1057960388 9:99450303-99450325 GAAGAGTGAAGGAGAAAAAGGGG - Intergenic
1058445083 9:105047978-105048000 CAGAAGTGAACGAGTTCAAGGGG - Intergenic
1058784089 9:108368570-108368592 AGAGAGTGAAGGAGTGAAATTGG - Intergenic
1059324661 9:113496952-113496974 CAGAAGTGAAGGAGTGAAAGAGG - Intronic
1059382701 9:113939769-113939791 AGGGAGGGAAGGAGGGAAAGAGG - Intronic
1059750726 9:117244769-117244791 AAGGAGGGAAGGAGGGATAGAGG + Intronic
1059942971 9:119375978-119376000 TAGGAGGGAATGAGTTGAAGTGG - Intergenic
1060141094 9:121210829-121210851 AAAGACTGAATGAGGTAAAGCGG - Intronic
1060579007 9:124726602-124726624 AAGGAGTGTTTGAGTTGAAGAGG + Intronic
1060607952 9:124934450-124934472 GAGGAATGCAGGAGTGAAAGGGG + Intronic
1061246062 9:129401780-129401802 AGGGAGAGAAGGAGGGAAAGAGG - Intergenic
1061696251 9:132376308-132376330 AAGGATTGAAGAAGTGAATGTGG - Intronic
1062321053 9:135990754-135990776 CAGGAGGGGAGGGGTTAAAGGGG - Intergenic
1062449206 9:136608444-136608466 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1203730953 Un_GL000216v2:88967-88989 AAAAAATGAAGCAGTTAAAGAGG - Intergenic
1185593018 X:1291224-1291246 AAAGAAGGAAGGAGGTAAAGAGG - Intronic
1185680027 X:1880946-1880968 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1185680075 X:1881275-1881297 AAGGAAAGAAGGAGTGAAGGAGG + Intergenic
1185680079 X:1881283-1881305 AAGGAGTGAAGGAGGGAGGGAGG + Intergenic
1185688256 X:1948238-1948260 AAGGAGAGAAGGAGGAAGAGGGG + Intergenic
1185688267 X:1948275-1948297 AAGGAGAGAAGGAGGAAGAGGGG + Intergenic
1185688546 X:2133777-2133799 AAGGAGAGAAGGAGGGAGAGGGG + Intergenic
1185688557 X:2133814-2133836 AAGGAGAGAAGGAGGAAGAGGGG + Intergenic
1185688568 X:2133851-2133873 AAGGAGAGAAGGAGGAAGAGGGG + Intergenic
1185834101 X:3329111-3329133 AAGGAGTAAAGGAGGGAAGGTGG + Intronic
1185834126 X:3329231-3329253 AAGGAGTAAAGGAGGGAAGGTGG + Intronic
1186091202 X:6050922-6050944 TAGGAGTTAAGGAGTTAGAAAGG + Intronic
1186107108 X:6219462-6219484 AAGGAGAGAAGGAGGGAAGGAGG - Intronic
1186406994 X:9313050-9313072 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1186490769 X:9970437-9970459 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186490772 X:9970445-9970467 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1186892021 X:13968306-13968328 AGAGAGTGAGGGAGTGAAAGAGG + Intergenic
1187085162 X:16034938-16034960 AAGGGGTGAAGGAGCTATTGTGG - Intergenic
1187421305 X:19136270-19136292 AAGGAATGAAGGGATTAAAAAGG + Intergenic
1187480206 X:19648364-19648386 AAGGAGGGAAGGAGGGCAAGAGG + Intronic
1187927348 X:24262328-24262350 AAGGAGTAAAGTATTTCAAGGGG - Intergenic
1188105210 X:26140933-26140955 AAGGAGGTAAGGAGTTAGAGAGG + Intergenic
1189362735 X:40365827-40365849 AAGGAAAGAAGGAATTGAAGGGG - Intergenic
1189588661 X:42488546-42488568 AAGGAGGGAAGGAGGAAAGGAGG - Intergenic
1189675505 X:43456877-43456899 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1189804880 X:44725338-44725360 CAGGAGTTAAGGAGTTAATCAGG - Intergenic
1191625668 X:63268412-63268434 AAAGAGTTAAGGATATAAAGAGG - Intergenic
1191778353 X:64842976-64842998 GAGGAGTGAGGGGGTGAAAGGGG - Intergenic
1191870715 X:65742724-65742746 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1192019584 X:67371928-67371950 AAGGAGTAATGGAGAAAAAGAGG + Intergenic
1192441065 X:71174132-71174154 CAGAAGAGAAGGAGTGAAAGAGG - Intergenic
1192550518 X:72049650-72049672 AAAGGGTGATGGAGTTATAGAGG - Intergenic
1192691317 X:73367495-73367517 AAAGTGTGAAAGAGTGAAAGGGG - Intergenic
1193310206 X:79998980-79999002 AAGAAGTGGAGAAGTGAAAGTGG + Intergenic
1193533110 X:82680348-82680370 AAGGAGAGAAGGAGGGAAGGAGG - Intergenic
1193824416 X:86205465-86205487 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1193824419 X:86205473-86205495 AAGGAGGGAAGGAGGGAAGGAGG - Intronic
1194465425 X:94229214-94229236 AAAGAGTGATAGAGTTAAATTGG + Intergenic
1194982545 X:100454999-100455021 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982549 X:100455015-100455037 AAGGAGGGAAGGAGAGAAGGAGG + Intergenic
1194982552 X:100455023-100455045 AAGGAGAGAAGGAGGGAAGGAGG + Intergenic
1194982555 X:100455031-100455053 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1194982557 X:100455039-100455061 AAGGAGGGAAGGAGGAAAGGAGG + Intergenic
1195376093 X:104229619-104229641 AAGGGGTGAATGAGGGAAAGTGG + Intergenic
1196684038 X:118495758-118495780 AAGGAGGGAAGGAGGGAACGAGG + Intergenic
1197207413 X:123801696-123801718 AAGGAGGGAAGGAGGGAAGGAGG + Intergenic
1197685130 X:129430971-129430993 AAGGAGAAAATGAGGTAAAGTGG - Intergenic
1198368404 X:135967023-135967045 AGGGATGGAAGGAGTGAAAGGGG + Intronic
1198473316 X:136970907-136970929 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic
1198683579 X:139205325-139205347 TAGGAGTAGAGGAGTTACAGGGG - Intronic
1198845440 X:140905592-140905614 AAGGAGTGAGGAAGTGAAAATGG + Intergenic
1199386892 X:147233227-147233249 AAGGAGAGAAGGAGAAAGAGAGG - Intergenic
1200908558 Y:8511020-8511042 AAGAAGGGAAGGAGGGAAAGCGG - Intergenic
1201298090 Y:12482407-12482429 TAGGAAGGAAGGAGTTAAAAAGG - Intergenic
1201642897 Y:16198425-16198447 AAGGAGTGAGTGAGTGAATGTGG + Intergenic
1201659918 Y:16386896-16386918 AAGGAGTGAGTGAGTGAATGTGG - Intergenic
1201741100 Y:17325454-17325476 AAGGAAGGAAGGAGTAAGAGAGG + Intergenic
1202193758 Y:22273888-22273910 AAGGAGGGAAGGAGGGAAGGAGG - Intergenic