ID: 1003360786

View in Genome Browser
Species Human (GRCh38)
Location 6:5423253-5423275
Sequence CTCTCTATCAAGCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003360786_1003360791 1 Left 1003360786 6:5423253-5423275 CCCCTCTGCTGCTTGATAGAGAG 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1003360791 6:5423277-5423299 ACGGGAGTGATCACTTACCCTGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003360786 Original CRISPR CTCTCTATCAAGCAGCAGAG GGG (reversed) Intronic
902592774 1:17486900-17486922 CCATCTATCAACCAGAAGAGGGG + Intergenic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
907419120 1:54334986-54335008 CTCTGACTCAAGCAGCACAGAGG + Intronic
907487358 1:54787099-54787121 GTCTCTAGGAAGCAGCAGGGTGG + Intronic
907603718 1:55794640-55794662 ATCTCTAGCTATCAGCAGAGAGG - Intergenic
911401310 1:97378800-97378822 CTTTCTAACAAGCAGGACAGAGG + Intronic
913276464 1:117143080-117143102 CTCTCTATCAATTACCAGTGTGG + Intergenic
916413030 1:164565765-164565787 CTCTGTATCAAGAAGAAGAGGGG - Intronic
916461040 1:165024687-165024709 CTCTATATCGAGAAGTAGAGAGG - Intergenic
916648804 1:166816410-166816432 ATCTCTAGCTATCAGCAGAGAGG + Intergenic
919673915 1:200362608-200362630 CTCTCCAGCAAGCAGCACAGTGG - Intergenic
919944168 1:202307683-202307705 CTCTCTATCCACCAACAAAGAGG + Intronic
920707014 1:208258967-208258989 CACCATCTCAAGCAGCAGAGGGG + Intergenic
922501508 1:226100270-226100292 TTCTCTTTCAAGCAGCAGTTTGG - Intergenic
1067142374 10:43668128-43668150 CTCTCTATCAAGCATGAAATAGG - Intergenic
1068601155 10:58958010-58958032 CTGTCTATCAAGCAGCATAATGG + Intergenic
1070100355 10:73380121-73380143 GTCTCTATCAAGCTGGTGAGGGG - Exonic
1071224166 10:83508714-83508736 CTCTCTAAAAAGAAGAAGAGTGG + Intergenic
1071265964 10:83965219-83965241 CACTGTATCAGGCATCAGAGAGG + Intergenic
1073230717 10:101967380-101967402 CTCACTGTCAATCAGCAGAGTGG + Intronic
1073329094 10:102659342-102659364 CTCTGTGACAAGCAGCAGGGAGG - Intergenic
1076933669 10:133552718-133552740 CTCTGAATCAACCAGCAAAGAGG + Intronic
1078253973 11:9641584-9641606 CTCTCTATCAATGACCAAAGGGG - Intergenic
1078315156 11:10288711-10288733 CTCTGCATCTATCAGCAGAGAGG + Intronic
1078852919 11:15180366-15180388 CTTTCTATGAGGCAGCAAAGAGG + Intronic
1081713212 11:45231297-45231319 TTCTCAAGCAAGCAGAAGAGTGG - Intronic
1082028194 11:47587660-47587682 ACCTCTACCAGGCAGCAGAGGGG + Intronic
1083915527 11:65740889-65740911 CTCAATATCAAGGGGCAGAGGGG + Intergenic
1084268713 11:68017962-68017984 CTGTTTAGCAAGAAGCAGAGTGG - Intronic
1086283014 11:85212797-85212819 CTTTCTATTAAGCAACAGGGAGG + Intronic
1093399016 12:18720466-18720488 ATATCTATCAAGCAGAAGACTGG + Intronic
1093908611 12:24720751-24720773 CTCCCTATCAAACATCAGAAAGG + Intergenic
1101870946 12:108564830-108564852 CTCACCATGAAGCAGCAGATTGG - Intronic
1102203827 12:111076633-111076655 CTCTCCATCACTCAGCAGACGGG + Intronic
1107233173 13:38136283-38136305 CTGTCTAGCTAGCAGCAGATGGG - Intergenic
1108904834 13:55455451-55455473 CTGTCTATAAAGCAGCAGCAAGG - Intergenic
1110264609 13:73523136-73523158 CTCTCTAGAAAGCAGCAGCAGGG + Intergenic
1110704758 13:78592775-78592797 CTCTCTATCAAACAGCTCTGGGG - Intergenic
1120242802 14:81969332-81969354 CTCCCTCTGAAGCAGCAGATAGG - Intergenic
1126543659 15:49848548-49848570 CTCTCTCTGGAGGAGCAGAGAGG + Intergenic
1127119622 15:55759793-55759815 CTATCAATCAAGCATGAGAGTGG - Intergenic
1127208491 15:56745801-56745823 CTATCTATAAAGAAGCAGAAGGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1132933378 16:2469681-2469703 CTCTTTATCAGGAAGCTGAGGGG + Intergenic
1133165798 16:3946476-3946498 TTCTCTATCAAGGCACAGAGAGG + Intergenic
1133210383 16:4260344-4260366 CTTTATATTAAGAAGCAGAGAGG + Intronic
1134142740 16:11735858-11735880 CTTTCTATAAAGCAACAGAAAGG - Intronic
1141219402 16:82055214-82055236 TTCTCAGTCAAACAGCAGAGAGG - Intronic
1141509193 16:84501638-84501660 CACTTTTTCAAGCAGGAGAGAGG + Intronic
1143039768 17:4025300-4025322 CTATCCATCAAGCAACTGAGTGG + Intronic
1143686822 17:8524011-8524033 CTCTCTTCCTAGCAGCAGACTGG - Intronic
1144027164 17:11287515-11287537 ATCTCTATAAATTAGCAGAGCGG + Intronic
1144487271 17:15677346-15677368 CTCTCTAAAATGCAACAGAGTGG - Intronic
1144590595 17:16520598-16520620 CTCCCTATCAACCTGCACAGTGG - Intergenic
1144605702 17:16663610-16663632 CTTGCTATGCAGCAGCAGAGAGG - Intergenic
1144913762 17:18704972-18704994 CTCTCTAAAATGCAACAGAGTGG + Intronic
1145312381 17:21707717-21707739 CTCTCCACCCAGCACCAGAGTGG + Intergenic
1149657933 17:58320007-58320029 CCCTCTCTCATCCAGCAGAGGGG - Intronic
1154200401 18:12296010-12296032 CTCTCTACCCAGCACGAGAGAGG + Intergenic
1156454130 18:37283292-37283314 CTCTCCACAAAACAGCAGAGGGG + Intronic
1159284098 18:66327011-66327033 TTCTCTAGCCAGCACCAGAGAGG + Intergenic
1162059346 19:8085498-8085520 GTCTCTGTCCAGCAGCAGTGAGG - Exonic
1167283656 19:48586442-48586464 CTCTGTATCCAGAAGCAGAGAGG + Intronic
1167927636 19:52834421-52834443 ATCTATATCAGGGAGCAGAGGGG - Intronic
925196511 2:1930295-1930317 CACTATATCACGGAGCAGAGCGG + Intronic
925683456 2:6447405-6447427 CTCTCTAACAAGCAGGGGACTGG + Intergenic
928938535 2:36704797-36704819 TTCTCTACCGAGCAGCAGAGGGG + Intronic
929454681 2:42057436-42057458 CTATCTATCAACCTCCAGAGAGG - Intronic
930029599 2:47049983-47050005 CTCACCATGAAGAAGCAGAGTGG + Exonic
930235311 2:48883735-48883757 TTCTCAAACAAGCAGGAGAGCGG + Intergenic
931782252 2:65588816-65588838 CTATCTTCAAAGCAGCAGAGTGG + Intergenic
937263593 2:120601894-120601916 CTCTCTACATAGCAGAAGAGTGG + Intergenic
937338336 2:121075683-121075705 CCCTGGATCAAGGAGCAGAGAGG + Intergenic
937705020 2:124910551-124910573 ATATTTTTCAAGCAGCAGAGAGG + Intronic
938238654 2:129725836-129725858 CTCTCTACCAAGGAGGACAGAGG + Intergenic
939465335 2:142547352-142547374 CTCTGTGCCAAGCAGGAGAGAGG - Intergenic
941921083 2:170851480-170851502 CTCTGTTTCAAGGAGAAGAGAGG - Intronic
942114307 2:172712991-172713013 CTCTGTAGCCATCAGCAGAGAGG + Intergenic
942227247 2:173828251-173828273 CTCACTATGAAGCATCAGTGAGG + Intergenic
946109525 2:217402329-217402351 CAATCAATCAAGCAGCGGAGGGG + Intronic
946435365 2:219648355-219648377 CTGTTTATCAAGCAACAGAAAGG + Intergenic
947688417 2:232112200-232112222 CTGGCAAGCAAGCAGCAGAGTGG - Intronic
1170296553 20:14832491-14832513 CCCTCTAGGAAGCAGCAGTGAGG - Intronic
1171219488 20:23382051-23382073 GTCTCTGTCAAGCAGGAAAGAGG + Intronic
1172277627 20:33688515-33688537 CTCTCCATAAAGAAGCTGAGGGG + Intergenic
1172347377 20:34213491-34213513 CTGTCTCTAAAGCAGCAGACTGG + Intronic
1174147439 20:48461887-48461909 GTCTCTCTCAAGCAGTAGAGAGG + Intergenic
1175080074 20:56412098-56412120 CGCCCTATAAAGCAGAAGAGTGG + Exonic
1175173782 20:57097468-57097490 CTCTCTGTCAAGCAGGACAGGGG + Intergenic
1178498279 21:33105115-33105137 TTCTCTACTAAGCAGCAGAAAGG - Intergenic
1180017069 21:45094300-45094322 GTCTTTATCAAGCAGTAGTGTGG + Intronic
1182094431 22:27616410-27616432 CTCTCTCTCAGGCAGCTGTGAGG - Intergenic
1183690391 22:39384749-39384771 CTCCCCATCAAGCACAAGAGAGG + Exonic
1184418134 22:44363950-44363972 CTCCCTGTCAATCATCAGAGTGG + Intergenic
950654619 3:14428880-14428902 CTCACTGTCACCCAGCAGAGAGG - Intronic
952874947 3:37936833-37936855 CTCTGTACCAAGCATCAGTGGGG - Intronic
954840183 3:53504724-53504746 CTCTGTATCAAGTGTCAGAGTGG + Intronic
956286757 3:67618542-67618564 CTCTCTCTTAATCAGCTGAGTGG - Intronic
958547043 3:95567322-95567344 GACTCGATCAAGCAGCTGAGGGG + Intergenic
958885590 3:99723144-99723166 CTCTCTAACAAGCAAAAAAGAGG + Intronic
961084117 3:124051943-124051965 CTCTCTCTTAAGCCTCAGAGAGG - Intergenic
964152750 3:153547714-153547736 GTCTCTACCAAGCAGCAAAGGGG - Intergenic
967314359 3:188137343-188137365 CTCTCTATTGACCATCAGAGTGG + Intergenic
968753726 4:2403659-2403681 CTCTCTGTCAAGAACCACAGTGG + Intronic
969857879 4:10014613-10014635 CTCTCTTTCAAGCCCCAGTGAGG + Intronic
970118268 4:12723571-12723593 GTCTCTAGAAAGCAGGAGAGAGG + Intergenic
972905352 4:43739663-43739685 CTCTCTCTCATGCATTAGAGAGG + Intergenic
973837549 4:54825386-54825408 CTCTCAGTCAAGAAGCACAGAGG - Intergenic
978724766 4:111957030-111957052 TTCTCTATCATGCTGCAGTGGGG - Intergenic
980244000 4:130214059-130214081 CTCTCTATCAGACAGCAGAGAGG - Intergenic
980652571 4:135738078-135738100 TTCTTTAGCAAGCAGCAGTGTGG + Intergenic
981520705 4:145659462-145659484 CACTCTATCAAGAAGCTGAGGGG - Exonic
986170929 5:5313961-5313983 TTCTCTATCCAGCAGCAGGCCGG - Intronic
986319245 5:6614543-6614565 CTCTCTTTCCAGCAGCAGTGGGG - Intronic
986545220 5:8889730-8889752 CTCTCCCTCAACCAGCTGAGAGG - Intergenic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
993626860 5:90235977-90235999 CTCTCCATCAAGCAGGAGCCAGG + Intergenic
995883752 5:116870490-116870512 CTCTTTATCAAACAGCAGTTTGG - Intergenic
997397595 5:133576640-133576662 ACCTCCATCCAGCAGCAGAGGGG + Intronic
999861788 5:155655759-155655781 CTCTCCAGGAGGCAGCAGAGGGG + Intergenic
1003360786 6:5423253-5423275 CTCTCTATCAAGCAGCAGAGGGG - Intronic
1004706853 6:18132524-18132546 CTCTATATCCTGCAGCAGAGCGG - Intronic
1005882050 6:30069386-30069408 CCCTCTATCAGGCAGAAGAGAGG - Exonic
1011410102 6:87058827-87058849 CTTCCTATCACACAGCAGAGGGG + Intergenic
1012929207 6:105299062-105299084 CCCTCTATCAAGAATCAGTGTGG - Intronic
1013320094 6:108979762-108979784 ATATCTATCAAGCAGAAGAAAGG - Intergenic
1015091510 6:129364277-129364299 CTCTCCATTAAGCAGCTCAGGGG + Intronic
1016048589 6:139506068-139506090 ATCTATATCAGGGAGCAGAGGGG + Intergenic
1018242631 6:161793368-161793390 CCCTCTTCCATGCAGCAGAGTGG - Intronic
1019382367 7:730727-730749 CTCTCCCTCCAGCAGCAGAGTGG + Intronic
1019402488 7:863807-863829 CTCTCTCTCTAGCAGTAGTGGGG + Intronic
1020519438 7:9168122-9168144 CAATCTATCAAGCAGAAGAAAGG - Intergenic
1023200035 7:37687070-37687092 TTCTTTATCAGGGAGCAGAGTGG - Intronic
1024516938 7:50267243-50267265 AACTCTATCATGCAGCAGTGGGG - Intergenic
1025065355 7:55850108-55850130 CTCTCTACAAAACAGAAGAGGGG + Intronic
1026548752 7:71348441-71348463 CTCTCTAGAAAGAAACAGAGGGG - Intronic
1026822069 7:73556773-73556795 CTCACTTCCAAGTAGCAGAGTGG - Intronic
1031857405 7:126939081-126939103 ATCTCTATCAATCAGAAGATGGG + Intronic
1031986948 7:128169347-128169369 CTCCATTTCCAGCAGCAGAGAGG + Intergenic
1032587697 7:133162861-133162883 CCCTCTATCTAGTAGGAGAGTGG - Intergenic
1039117661 8:34110592-34110614 ATCTCCATTAAGCAGCAGTGTGG - Intergenic
1043557161 8:81444763-81444785 CTCTCTCTCAAGCAGCCCACTGG + Intronic
1043626645 8:82269511-82269533 CTCTGAAGCTAGCAGCAGAGGGG + Intergenic
1044472864 8:92591697-92591719 ATCTGCATCCAGCAGCAGAGAGG + Intergenic
1048453198 8:134552721-134552743 CTATTTGTCAAACAGCAGAGAGG + Intronic
1049131568 8:140849268-140849290 CTTTCTCTCTGGCAGCAGAGGGG - Intronic
1049175639 8:141190824-141190846 CTCTGTGCCAAGCAGCCGAGGGG - Intronic
1049374502 8:142282588-142282610 GTGTCTATCAATGAGCAGAGGGG + Intronic
1049374551 8:142282849-142282871 GTGTCTATCAATGAGCAGAGGGG + Intronic
1049374567 8:142282936-142282958 CTGTCTGTCAATGAGCAGAGGGG + Intronic
1049374594 8:142283081-142283103 GTGTCTATCAATGAGCAGAGGGG + Intronic
1058438372 9:104985247-104985269 CTTTGTAGCTAGCAGCAGAGGGG + Intergenic
1059681566 9:116590870-116590892 CTCTCTAGCTCTCAGCAGAGAGG - Intronic
1059777569 9:117491069-117491091 TTCTCTATCAAACATCAGATAGG - Intergenic
1060332132 9:122682823-122682845 CTCTCCTTGAAGCAGCACAGTGG - Intergenic
1060733949 9:126054557-126054579 ATATCTAGGAAGCAGCAGAGTGG - Intergenic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1186659563 X:11655893-11655915 CTCTTTTTCAAGCACCAGATTGG + Intronic
1187475341 X:19605723-19605745 CTTTCAATCAACCAGCACAGTGG + Intronic
1191179105 X:57540502-57540524 CTCTCCACCAAGCAGAAGAAAGG - Intergenic
1195032340 X:100938275-100938297 CTCTCTCACAAACAGCAGTGTGG + Intergenic
1195330568 X:103795432-103795454 CTATCTTTCAAGCATCAAAGGGG + Intergenic