ID: 1003362705

View in Genome Browser
Species Human (GRCh38)
Location 6:5444015-5444037
Sequence AACCAGACAGGGATTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003362695_1003362705 28 Left 1003362695 6:5443964-5443986 CCACTGAAATAGTTTCTCAGTAT No data
Right 1003362705 6:5444015-5444037 AACCAGACAGGGATTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003362705 Original CRISPR AACCAGACAGGGATTGGTGG TGG Intronic