ID: 1003362705 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:5444015-5444037 |
Sequence | AACCAGACAGGGATTGGTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1003362695_1003362705 | 28 | Left | 1003362695 | 6:5443964-5443986 | CCACTGAAATAGTTTCTCAGTAT | No data | ||
Right | 1003362705 | 6:5444015-5444037 | AACCAGACAGGGATTGGTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1003362705 | Original CRISPR | AACCAGACAGGGATTGGTGG TGG | Intronic | ||