ID: 1003369651

View in Genome Browser
Species Human (GRCh38)
Location 6:5511857-5511879
Sequence CAGGTTCAGGAGTCTGTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003369642_1003369651 27 Left 1003369642 6:5511807-5511829 CCCCTTTTATTTCTCTGAGTGGC 0: 1
1: 0
2: 3
3: 57
4: 1117
Right 1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG 0: 1
1: 0
2: 3
3: 16
4: 170
1003369648_1003369651 -5 Left 1003369648 6:5511839-5511861 CCCTAAATAGAACAGGGACAGGT 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG 0: 1
1: 0
2: 3
3: 16
4: 170
1003369644_1003369651 25 Left 1003369644 6:5511809-5511831 CCTTTTATTTCTCTGAGTGGCTG 0: 1
1: 1
2: 63
3: 164
4: 547
Right 1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG 0: 1
1: 0
2: 3
3: 16
4: 170
1003369649_1003369651 -6 Left 1003369649 6:5511840-5511862 CCTAAATAGAACAGGGACAGGTT 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG 0: 1
1: 0
2: 3
3: 16
4: 170
1003369643_1003369651 26 Left 1003369643 6:5511808-5511830 CCCTTTTATTTCTCTGAGTGGCT 0: 1
1: 0
2: 1
3: 37
4: 468
Right 1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG 0: 1
1: 0
2: 3
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003369651 Original CRISPR CAGGTTCAGGAGTCTGTTAG AGG Intronic
901765699 1:11498665-11498687 CAGGTACATGTATCTGTTAGGGG + Intronic
904833162 1:33318572-33318594 CAGGGTCAGGAGGCTGTTATAGG - Intronic
905777218 1:40676402-40676424 CTGGTTAAAGAGCCTGTTAGAGG + Intergenic
905876388 1:41434415-41434437 CTGGTGCAGGAGCCTGTTGGCGG + Intergenic
906399086 1:45491486-45491508 CAAGTCCAGGAGCCTCTTAGAGG + Intergenic
908640239 1:66214954-66214976 CAGGTACTGGAGTGTGGTAGGGG + Intronic
909322744 1:74310069-74310091 CAGGTCTAGGAGTCTTTTGGAGG - Intronic
909708452 1:78615433-78615455 CAGGTCTAGGAGTCTTTTGGAGG + Intergenic
910391845 1:86753854-86753876 CAGGTCCTGGAATCTGTCAGGGG + Intergenic
913413991 1:118584563-118584585 CAGGGTCTGGAGTCTGTAAGGGG - Intergenic
914975476 1:152356961-152356983 CAGGTTCAGGAGACAGTGGGAGG - Exonic
916648036 1:166807446-166807468 CAGGTTCAGGTGTCTGACAAGGG + Intergenic
919584294 1:199416807-199416829 CAAGTCTAGGAGTCTTTTAGAGG - Intergenic
920695253 1:208176899-208176921 CAGGTTCAGGGGACTATGAGTGG - Intronic
920809978 1:209275168-209275190 CAGGTACAGGAGTCTTTTGGAGG + Intergenic
921404829 1:214767241-214767263 CAGGCTCAGCAGCCTGTTGGAGG + Intergenic
921474251 1:215586970-215586992 CAGGTTCAGTAGTTTGAGAGGGG - Intronic
924682798 1:246255008-246255030 CAGTTTCAGGAGCCTTTTGGTGG + Intronic
1062933832 10:1370563-1370585 CAAGTCTAGGAGTCTTTTAGAGG - Intronic
1063259329 10:4367667-4367689 CTGGTTCAGGATTTTGATAGTGG - Intergenic
1063265183 10:4440574-4440596 CAGGTACTGTTGTCTGTTAGTGG + Intergenic
1063293666 10:4778639-4778661 AAGGAACAGGAGTCCGTTAGGGG - Intergenic
1067579735 10:47435197-47435219 CAGGTCAAGGAGTCTTTTGGAGG + Intergenic
1068339026 10:55676932-55676954 CAAGTTTAGGAGTCTTTTGGAGG + Intergenic
1071038526 10:81277824-81277846 AGGGTTCAGGAATCAGTTAGGGG + Intergenic
1072227657 10:93385157-93385179 CAGGATCAAGAGTCTGTTCTTGG - Intronic
1077026325 11:441601-441623 CGTGTTCAGGACTCTGGTAGAGG + Intronic
1079474646 11:20816526-20816548 CAGTTATAGGAGTCTTTTAGTGG + Intronic
1079881917 11:25939098-25939120 CAGGTTCAGGAAACTCCTAGAGG - Intergenic
1080421042 11:32110668-32110690 CTGATTCAGGAGCCTCTTAGTGG + Intergenic
1081228500 11:40555130-40555152 CAGGTCCAGGAGTTTTTTGGTGG + Intronic
1082114000 11:48308093-48308115 CAGCTTCAGAAGGCTGTGAGAGG + Intergenic
1082697110 11:56381892-56381914 GAGGTTCACTAGGCTGTTAGGGG - Intergenic
1084983111 11:72843248-72843270 CATGCTCAGGAGGCTGTTCGAGG + Exonic
1085172590 11:74461986-74462008 CAGTTTCAGGAGTCCCTTTGTGG + Exonic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1089600978 11:119614818-119614840 AAGGTTCAGGTGTCTGATGGGGG - Intergenic
1089857892 11:121562883-121562905 CAGTTTCAGGTGTCAGCTAGGGG + Intronic
1090395030 11:126413474-126413496 CAGGGGCAGGAGGGTGTTAGTGG - Intronic
1091831830 12:3555567-3555589 CAGGTGCTGCAGTCTGTTGGAGG + Intronic
1098171547 12:67751954-67751976 CATATTCAGGAGGCTGTTGGAGG + Intergenic
1098892973 12:76028822-76028844 CTTGTTGAGGAGTCTGTTGGGGG - Exonic
1110638665 13:77795592-77795614 CAGTTCCAGGAGTCTTTTGGTGG - Intergenic
1111080205 13:83295636-83295658 CAGTTTCAGGAGTCTTTTGATGG + Intergenic
1111279966 13:86009708-86009730 AAGGATCAGGAGTCAGTGAGGGG + Intergenic
1112714990 13:102174053-102174075 CAAGTTTAGGAGTCTTTTGGAGG - Intronic
1113293798 13:108935499-108935521 CAGCTTCAGGAGCCTTTTGGTGG + Intronic
1116780694 14:49234674-49234696 CAGTTGCAGGAGTCTTTTAGTGG + Intergenic
1117345985 14:54833013-54833035 CAGTTCCAGGAGCCTTTTAGTGG + Intergenic
1121326599 14:93023847-93023869 CAGGTTGAGGGGACTGCTAGGGG - Intronic
1121545218 14:94758235-94758257 CATCTTCAGGAGTCTGGAAGGGG + Intergenic
1121654765 14:95587282-95587304 CAGGTTCACAGGGCTGTTAGTGG - Intergenic
1122258438 14:100498110-100498132 CAGTTTCAGGAGTGTGTTGATGG + Intronic
1125428769 15:39575876-39575898 CAGGTCCTGGAGACTGTTGGTGG - Intergenic
1126741533 15:51781477-51781499 CAGTGTCAGGAATCTGGTAGTGG + Intronic
1127815434 15:62604610-62604632 CAGGTTCAGGAGGGTGTTGGTGG + Intronic
1127821994 15:62666448-62666470 CAGGTTCAGCTGTCTGGTATGGG - Intronic
1129105185 15:73302253-73302275 CAGGTACAGGATTCTCTAAGCGG + Intronic
1137374214 16:47938527-47938549 CAGGTCTAGGAGTCTTTTGGAGG - Intergenic
1137659651 16:50193637-50193659 CAGGTCCTGGAGTCTTTAAGAGG + Intronic
1142111199 16:88332670-88332692 CGGGTTCTGGAGTCCCTTAGGGG - Intergenic
1142614303 17:1125856-1125878 CAGGTTCTGGAGTGTGGGAGGGG + Intronic
1143336948 17:6178590-6178612 CAGGCTGTGGACTCTGTTAGAGG - Intergenic
1144932670 17:18872594-18872616 CAAATTCAAGAGTCTGTGAGGGG + Exonic
1147412343 17:40262712-40262734 CAGGTTGAGGAGTATGGTAGAGG + Intronic
1150633469 17:66896773-66896795 CAGGTTCATTACGCTGTTAGTGG + Intergenic
1152300483 17:79492634-79492656 GAGGTTCAGGAATCTGGGAGGGG - Intronic
1152345113 17:79746764-79746786 CAGGTTAAGGAGTGTGGGAGTGG - Intergenic
1155324133 18:24649201-24649223 CAGGTTCAGTTGTCTGATAAAGG + Intergenic
1157915342 18:51658863-51658885 CAGGGACAGCACTCTGTTAGGGG - Intergenic
1162486523 19:10963726-10963748 CAGGTGCAGCAGTGTGTTAGCGG - Intronic
1163836179 19:19575718-19575740 CAGGTCCAGAAGGATGTTAGAGG - Intronic
1165637793 19:37357725-37357747 CAGGTTTAGGAGTCTTTTGGAGG + Intronic
1167324819 19:48817823-48817845 TAGGTACAGGAGAATGTTAGAGG - Intronic
1167957665 19:53080027-53080049 CAGGTCTAGGAGTCTTTTAGTGG - Intronic
1168488037 19:56781566-56781588 CAGATTCTGGAGTCTGCTTGGGG + Intronic
925531256 2:4865120-4865142 CAGGTGCAGGAGTATCTCAGAGG + Intergenic
925772333 2:7295185-7295207 CAGTCTCAGGAGTCTGAAAGGGG + Intergenic
927555752 2:24030501-24030523 GAGGTTGAGGAGTCTGCTGGGGG - Exonic
930303494 2:49647799-49647821 CAGTTTTAGGAGCCTGTTGGAGG + Intergenic
930628242 2:53722950-53722972 CAGCTTCAGGAGCCTTTTTGTGG - Intronic
932661934 2:73662570-73662592 CAGGTCCAGGAGGCTTTTGGTGG + Intergenic
933198919 2:79425468-79425490 CAGGTTCAGTTGTCTGGTAAGGG + Intronic
934637881 2:96007628-96007650 CAGTTTCAGGCATCTGCTAGGGG + Intergenic
935837676 2:107073180-107073202 CCGGTTCTGGAGTGTTTTAGTGG + Intergenic
939000016 2:136723842-136723864 CAGTTCCAGGAGTCTTTCAGTGG + Intergenic
939013248 2:136872007-136872029 CACGTTCAGCAGGATGTTAGAGG + Intronic
940403932 2:153279239-153279261 CAGTTCCAGGAGCCTTTTAGAGG + Intergenic
944092544 2:195928983-195929005 CAGCTCCAGGAGTCTTTTGGTGG - Intronic
947322535 2:228938135-228938157 CATGTTCAGGAGTGGGTGAGTGG - Intronic
947997141 2:234537574-234537596 CATCTTCAGGAAACTGTTAGAGG + Intergenic
1168740426 20:185681-185703 CAGTTCCAGGAGTCTTTTGGTGG - Intergenic
1169743877 20:8923480-8923502 CAAGTCCAGGAGTCTTTTGGAGG - Intronic
1170070828 20:12364761-12364783 CAGGTCTAGGAGTCTTTTGGTGG - Intergenic
1170841700 20:19929247-19929269 CAGGTACAGGGATGTGTTAGAGG + Intronic
1175618071 20:60420444-60420466 CAGGTTCAGGCTTCTATGAGAGG - Intergenic
1177071596 21:16515706-16515728 CAGTTCCAGGAGTCTTTTGGTGG + Intergenic
1177588187 21:23126625-23126647 CAGATTCAGGTATCTGTTATAGG - Intergenic
1180030573 21:45203842-45203864 CAGTTTCAGGAGTCTACTGGGGG - Intronic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
950097432 3:10338156-10338178 CAGGTACAGGAGGCTCTTGGGGG - Exonic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
954001797 3:47563491-47563513 CAGGTTCAGGAGTTTGTCAGAGG - Intronic
956279020 3:67536696-67536718 TGGGCTCAGGAGTCTGTGAGAGG - Intronic
957572017 3:81959034-81959056 AAGGTCTAGGAGTCTTTTAGTGG + Intergenic
960598698 3:119433355-119433377 CTGGTTCAGAAGTCTGATATAGG + Intronic
961599728 3:128051661-128051683 CAGGTTGAGGAGACTGTTGTGGG - Intronic
962210224 3:133471481-133471503 CAGGTTCAGGAGGCAGCCAGTGG + Intronic
963334328 3:143955655-143955677 CAGGTTCAGTTGTCTGGTAAGGG + Intergenic
966577295 3:181516741-181516763 CAGTTTCAGGAGCCTTTTGGTGG + Intergenic
968953435 4:3706437-3706459 AAGTTTCCGGAGGCTGTTAGGGG - Intergenic
969144496 4:5109876-5109898 CAGGTTTAGGAGTCTTCTAGAGG - Intronic
969163478 4:5282175-5282197 CAGTTTCAGGTATCTGCTAGGGG - Intronic
970276348 4:14405144-14405166 CAGGATAAGAAGTCTGTTATTGG - Intergenic
970871903 4:20826031-20826053 CAGGTTCAGTGGAATGTTAGGGG + Intronic
971114190 4:23624641-23624663 CAGTTTCAAGAGTCTTTTGGTGG - Intergenic
973227302 4:47801290-47801312 AAGGTGCAGGAGTCTGATACAGG - Intronic
973806146 4:54527816-54527838 CAGGTGCGGGATTCTGTTTGAGG - Intergenic
975065615 4:70059962-70059984 CAGTTCCAGGAGTCTTTTGGTGG + Intergenic
978172428 4:105689268-105689290 CAGTTTGAGGAATCTGTTTGAGG + Intronic
979976189 4:127198803-127198825 CAGGTCTAGGAGTCTTTTGGAGG - Intergenic
981758574 4:148168498-148168520 CAAGTTCAGTGGCCTGTTAGCGG + Intronic
982510216 4:156273455-156273477 CAGGTCTAGGAGTCTTTTGGAGG + Intergenic
983173525 4:164562051-164562073 CAGGTCTAGGAGTCTTTTGGTGG + Intergenic
985843832 5:2329768-2329790 CAGGTTCAGGAGGCTGGGAGGGG - Intergenic
986690794 5:10312079-10312101 GAGGTTCAGGAGTCTGGGAGTGG - Intergenic
989441457 5:41476729-41476751 CAGGTTCAACAGTTTGCTAGGGG - Intronic
991112099 5:62912557-62912579 CAGGTCTAGGAGTCTTTTGGAGG + Intergenic
991278674 5:64883680-64883702 CAGTTTCAGTAGACTGTAAGAGG + Intronic
993336555 5:86666615-86666637 AAGGTTAAGTAGTCTGTGAGTGG - Intergenic
996218923 5:120904326-120904348 CAGGTTTAGGAGTCTTTTAGAGG + Intergenic
996769607 5:127072449-127072471 CAAGTTGAGGTGTCTATTAGAGG - Intronic
997197124 5:131987675-131987697 TAGGTCCAGGAGTCTGGGAGAGG - Intronic
997356711 5:133267197-133267219 GAGGTGCAGGATTCTGGTAGGGG + Intronic
998703769 5:144735183-144735205 CAGTTCCAGGAGTCTTTTGGTGG + Intergenic
998988528 5:147789290-147789312 CAGGATCAGGAGTGTGATCGAGG - Intergenic
1001740677 5:174050695-174050717 CAGGTCCAGGAGCCTGCCAGGGG - Intronic
1002552353 5:180004535-180004557 CAGCTTGAGGGGTTTGTTAGGGG + Intronic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1003389178 6:5698678-5698700 CAGGTCCAGGAGCCTGGCAGAGG - Intronic
1005494173 6:26374514-26374536 CAGGATCAGGAGTTTCTCAGAGG - Intronic
1005503410 6:26449849-26449871 CAGGGTCAGGAGTCTCTCAGAGG - Intronic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006105492 6:31713822-31713844 CAGGCTCAGGAATCTGGGAGAGG + Exonic
1008185366 6:48383272-48383294 CAGGTCTAGGAGTCTTTTGGAGG + Intergenic
1010470957 6:76227901-76227923 CAGGTTCAGTTGTCTGGTAAGGG - Intergenic
1010629269 6:78177693-78177715 CAGTTCCAGGAGTCTTTTGGTGG - Intergenic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1013983492 6:116162157-116162179 TAGGTCCAGGAGTCTTTTGGAGG + Intronic
1015060955 6:128964997-128965019 CTGTTTCAAGAGTCTGTAAGAGG + Intronic
1015119716 6:129687637-129687659 CAGGTTAAGGTGTGGGTTAGAGG - Intronic
1018066909 6:160131028-160131050 CAGGATGAGGAGGCTGATAGGGG + Intronic
1019357467 7:588101-588123 CAGCTCCAGGAGTCTGTTTCTGG - Intronic
1023283492 7:38595062-38595084 CAGGGACAGGAGTCTGCTAATGG + Intronic
1024955142 7:54910570-54910592 GGAGTTCAGGAGGCTGTTAGTGG - Intergenic
1026960383 7:74404110-74404132 CAGCTTCTGGAGTTTGTCAGTGG + Exonic
1027949519 7:84796617-84796639 CAGTTCCAGGAGTCTTTTTGTGG + Intergenic
1029231736 7:99075409-99075431 CAGGTTCAGTAATTTGCTAGAGG - Intronic
1032577298 7:133068884-133068906 CAAGTTGAGGAATCTGTAAGGGG + Intronic
1033147348 7:138882876-138882898 CAGGCTCAGGGGTCTGTCATGGG - Intronic
1033237851 7:139652431-139652453 CATGTTCAAGACTCTGCTAGAGG + Intronic
1034828876 7:154291616-154291638 GAAATTCAGGAGTCTGTTAGTGG - Intronic
1035288155 7:157819288-157819310 CAGGGACAGGAGTGTGGTAGAGG + Intronic
1035452417 7:158986074-158986096 TTTGTTCAGGAGTCTGTGAGGGG + Intergenic
1037502721 8:19500885-19500907 CAGGTTCAGTTGTCTGGTAAGGG + Intronic
1037525014 8:19716141-19716163 TAGATTCAGGACTGTGTTAGAGG - Intronic
1039038222 8:33382808-33382830 GAAGTTCAGGAATCTGCTAGAGG - Intronic
1039153611 8:34530714-34530736 CAGGTTCAGTAGGATGTCAGAGG + Intergenic
1049370506 8:142262016-142262038 CAGCTTCATGAGCCTGTGAGAGG - Intronic
1049967363 9:791739-791761 CAGGTTCAGGAGTAGGCTGGAGG + Intergenic
1051150964 9:14078761-14078783 CAGGTACAGGACACTGGTAGAGG + Intergenic
1052028144 9:23597495-23597517 CAGCTTCTGGATTCTGTCAGTGG + Intergenic
1052978975 9:34433579-34433601 CAGGTTGAGGAGTTTTTAAGTGG - Intronic
1055345387 9:75330680-75330702 CAGGTCTAGGAGTCTTTTGGAGG - Intergenic
1056921327 9:90791970-90791992 CAGGCTAAGGAGTCTGTTTCTGG + Intergenic
1057365892 9:94420360-94420382 GAGGGGCAGGAGTCTGGTAGCGG + Intronic
1058020991 9:100088487-100088509 AAGGATCAGGAGTGTATTAGGGG - Intronic
1186041824 X:5487474-5487496 CAGGTTGAGAAGTCAGTTTGTGG - Intergenic
1188743729 X:33816915-33816937 CAGCTTCAGCAGAGTGTTAGTGG + Intergenic
1193649595 X:84113889-84113911 CAAGTCTAGGAGTCTGTTGGAGG - Intronic
1196595650 X:117542638-117542660 CAGGATAATGAGTCTGCTAGAGG - Intergenic
1197048894 X:122034481-122034503 AAAGTTCAGGAGTCTTTTGGAGG + Intergenic
1197705573 X:129632254-129632276 CAGGTTCAGTTGTCTGTTGAGGG - Intergenic
1201412660 Y:13716287-13716309 CAGATTCATGACTCTGTTGGAGG + Intergenic
1202269031 Y:23052866-23052888 CAGCTTCAGAAGAGTGTTAGTGG + Intergenic
1202422023 Y:24686606-24686628 CAGCTTCAGAAGAGTGTTAGTGG + Intergenic
1202448763 Y:24983472-24983494 CAGCTTCAGAAGAGTGTTAGTGG - Intergenic