ID: 1003377120

View in Genome Browser
Species Human (GRCh38)
Location 6:5589653-5589675
Sequence ACCACTGGTGTTCCCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003377120_1003377124 8 Left 1003377120 6:5589653-5589675 CCATATCTGGGAACACCAGTGGT 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1003377124 6:5589684-5589706 AAGAGTCTGGTTGCTGAGATTGG 0: 1
1: 0
2: 1
3: 20
4: 175
1003377120_1003377122 -5 Left 1003377120 6:5589653-5589675 CCATATCTGGGAACACCAGTGGT 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1003377122 6:5589671-5589693 GTGGTATCCTGCTAAGAGTCTGG 0: 1
1: 0
2: 1
3: 4
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003377120 Original CRISPR ACCACTGGTGTTCCCAGATA TGG (reversed) Intronic
900686267 1:3949938-3949960 ACCCATGGTGTTACCAGAAAAGG - Intergenic
904871007 1:33618204-33618226 ACCAGTGCTGCTCCCAGAAAGGG - Intronic
906311307 1:44756497-44756519 CCCACTGGGGTTCACAGATTTGG + Intronic
906345878 1:45014035-45014057 ACCACTTGTCCTACCAGATATGG - Exonic
907158523 1:52355327-52355349 AGCACTGGTGTTTCCAGAGTGGG - Intronic
907873911 1:58467141-58467163 ATCACTGCTTTTCACAGATAAGG - Intronic
917616108 1:176746079-176746101 ACCACTGGTTGTCCCACACATGG + Intronic
920827911 1:209438850-209438872 ACCACTGGTGTTTCCTGAATAGG - Intergenic
1063314016 10:4984188-4984210 CCCACTGGTGTTCCCTTATGTGG + Intronic
1068588315 10:58826329-58826351 ACCACATGAGTTCCCAGACACGG + Intronic
1069249115 10:66245969-66245991 ACCATTGGTGGGCCCAGAAAAGG + Intronic
1071294072 10:84206638-84206660 ACCAGTGGAGTTCCCAAATTTGG + Intronic
1074625825 10:115185245-115185267 AGCACTCGTATTCCCAGATCTGG + Intronic
1075717938 10:124567651-124567673 GCCACTTGTGTTCCCAGCTGTGG + Intronic
1076312043 10:129515353-129515375 ACTTGTGGTGTTCCCAGATTTGG + Intronic
1078270742 11:9792524-9792546 ACCACAGGTGTTCCTAAACAAGG + Intronic
1083299960 11:61735133-61735155 ACCTCTGGTCTGCCCAGCTAGGG - Intronic
1084128488 11:67117015-67117037 CACACTGGTGCTACCAGATATGG - Intergenic
1087483030 11:98726020-98726042 AACACTGGTTATCACAGATAAGG - Intergenic
1088361974 11:109001031-109001053 ACCACTGATGTTCCCTTACATGG + Intergenic
1093018947 12:14185477-14185499 ACCAGGGCTGCTCCCAGATATGG + Intergenic
1097233677 12:57526347-57526369 GCCACTGGTGGTCCCAGGCAGGG - Exonic
1098539703 12:71640503-71640525 ACCACTGGTGGTCCCAGAGCAGG - Intronic
1102067560 12:109990280-109990302 ACCACTGGTGGTTCCACATTTGG + Intronic
1110046612 13:70841019-70841041 ACCCCTGGTGTTCCTGGAAAGGG - Intergenic
1110572090 13:77015908-77015930 AACACTAGGGTTTCCAGATATGG - Intronic
1112859425 13:103812030-103812052 CACACTGGTGGTCCCAGCTATGG + Intergenic
1114716387 14:24830104-24830126 ACCACTGGTGTGGCCATAGAAGG + Intronic
1118492662 14:66276733-66276755 ACCAGTGCTGTTCCCAGACTTGG + Intergenic
1120142959 14:80949033-80949055 ACCACTTTTGTTCCCAGCAAAGG + Intronic
1120772189 14:88391389-88391411 ACCTCTGTCCTTCCCAGATATGG + Exonic
1128818537 15:70631511-70631533 AGCACTGGTGTCCCCAGTTTGGG - Intergenic
1132134578 15:99322527-99322549 TACAGTGGTGTTCCCAGATTTGG + Intronic
1132134896 15:99326142-99326164 TACAGTGGTGTTCCCAGATTTGG + Intronic
1132780713 16:1623419-1623441 AGCACTGGTGATCCAAGACAAGG - Intronic
1140949791 16:79805949-79805971 ACCACAGGTGTTCTCTGAAATGG + Intergenic
1145025582 17:19465708-19465730 AACACTGGTGTTCCATGAAAGGG - Intergenic
1148448437 17:47756279-47756301 ACCACTGGTTTTTCCAGATAGGG + Intergenic
1149033988 17:52114645-52114667 ACCAGTGTTGGTCCCAGAGAAGG - Intronic
1150432421 17:65129077-65129099 ACCCTTGGTTTTCCCAGAAATGG - Intergenic
1151942921 17:77304174-77304196 GCCACTGCTGTTCCCAGGAAGGG - Intronic
1152901707 17:82945018-82945040 ACCAGTGGTATTCCCAGACAAGG + Intronic
1153020518 18:624534-624556 ATCACAGTTGTTCCCAGATCGGG + Intronic
1158004852 18:52660910-52660932 ACCACTGATGTTCCCCAGTATGG + Intronic
1160538812 18:79609690-79609712 GCCACTGGTGTCCCCAGAAAAGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160866792 19:1259750-1259772 ACCAGGGGTGTTCCTAGACAGGG - Intronic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
925527800 2:4822760-4822782 AAAGCTGGTGTTACCAGATATGG - Intergenic
925991722 2:9259977-9259999 ACCACAGAGTTTCCCAGATAGGG - Intronic
940524228 2:154791599-154791621 ACCACTGCTGTTCACAGTCATGG - Intronic
942670326 2:178368329-178368351 ACCACTGGGGTTGCCAGAGTGGG + Intronic
946845471 2:223855050-223855072 ACCACTAGTGTTACCAGAAAGGG - Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1176243428 20:64085319-64085341 GCCACTGGTGTTCACAGAAAGGG + Intronic
1178007799 21:28242449-28242471 AGCACCAGTGTTCTCAGATAAGG - Intergenic
1178532424 21:33386598-33386620 GCCCCTGAGGTTCCCAGATAAGG - Intergenic
1181618403 22:24070957-24070979 ACCACTGCTGTCCGCAGAGAGGG - Exonic
949705580 3:6813217-6813239 ACTAGTGGTGATTCCAGATATGG + Intronic
956750038 3:72337895-72337917 ACCCCTGCTGTCCCCAGGTAGGG - Intergenic
957227306 3:77466492-77466514 ACCATTGGAGGTCCTAGATAGGG - Intronic
960147087 3:114215080-114215102 AGCACAGGTGTGCTCAGATAAGG + Intergenic
961314302 3:126024067-126024089 ACCACTGGTGTTCCTTTAAATGG - Intronic
962433148 3:135338681-135338703 ACCACTGGGGTTCCCATTGACGG - Intergenic
975496244 4:75038851-75038873 ATCACTGGTCTTAGCAGATACGG - Intronic
985057958 4:186051567-186051589 ACAACCGGTGTCCCCAAATATGG + Intergenic
991288338 5:65005546-65005568 ACCACTGGTGGTGACAGATGGGG + Intronic
996030061 5:118694850-118694872 TCGACTGTTGTTCCTAGATATGG - Intergenic
996337160 5:122397254-122397276 ACCTCTGGTTTTCCCAGTTCAGG + Intronic
998280763 5:140805043-140805065 AGTACTTGTCTTCCCAGATATGG + Intronic
999400801 5:151262830-151262852 GCCACTGGTGTTTCCAGGGAGGG + Intronic
1003377120 6:5589653-5589675 ACCACTGGTGTTCCCAGATATGG - Intronic
1003459654 6:6318424-6318446 TCCACTGGGGTTCCCACAAAAGG - Intronic
1004273505 6:14215131-14215153 ACAAATGGTGTTCCTATATATGG - Intergenic
1005994048 6:30921120-30921142 AGCACTGGTTTTCCCATATTGGG + Exonic
1006244221 6:32716171-32716193 ACTTCTGGTGATCCCAGATTAGG + Intergenic
1008298996 6:49811226-49811248 AACACTGGGGATCCCAGAAAAGG + Intergenic
1012231165 6:96762553-96762575 ACCACGGGTGGGCCCAGAAAAGG + Intergenic
1018208041 6:161453830-161453852 ACAACTAGTATTCCCAGAAAGGG - Intronic
1018422878 6:163654549-163654571 ACCAATGGTGAGCCCCGATATGG - Intergenic
1019131319 6:169879014-169879036 AACATTGCTGTTCCCAGATGGGG + Intergenic
1019706754 7:2500440-2500462 ACCACTGGAGTTCCCAGAGCGGG - Intergenic
1022010892 7:26307342-26307364 AAGACTGGTGTTCCCAGAATGGG - Intronic
1023756890 7:43427694-43427716 ACCACTTGTGTTCTCATCTAGGG + Intronic
1025598468 7:62962956-62962978 GCCAATGGTATTCCCAAATAGGG + Intergenic
1029659638 7:101951374-101951396 GGGACTGGTGTTCCCAGACATGG - Intronic
1033479639 7:141727109-141727131 ACAACTGGTGCTACCAGACATGG + Intronic
1034897376 7:154886161-154886183 TGCACAGGTGTTACCAGATAAGG + Intronic
1037829506 8:22179412-22179434 CCCACTGGTGCTCCCAGCTCAGG - Intronic
1048849064 8:138627271-138627293 ATCACTGGTGTTTCCACATTAGG - Intronic
1052457995 9:28725623-28725645 ACCACTGGTTTGCAAAGATAAGG + Intergenic
1052748740 9:32467263-32467285 ACCACTGGTGTTTCAATACAAGG + Intronic
1060623207 9:125086364-125086386 ACCACAGGTGGTCAGAGATAAGG + Intronic
1061544625 9:131297339-131297361 ACCACTGGTCTTCAAAGATAGGG + Intronic
1188859866 X:35244070-35244092 ACCACGGGTGGGCCCAGAAAAGG + Intergenic
1189545853 X:42042107-42042129 AACACTGGTTTTACCAGATTAGG + Intergenic
1195001029 X:100643560-100643582 ACCACTGATTTTCCAAGAGATGG + Intergenic
1199839806 X:151633342-151633364 ACACCTGGTGTTAGCAGATAAGG + Intronic