ID: 1003378873

View in Genome Browser
Species Human (GRCh38)
Location 6:5604273-5604295
Sequence ACTCCCATCTACACTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003378871_1003378873 -10 Left 1003378871 6:5604260-5604282 CCAGGTCTGCCACACTCCCATCT 0: 1
1: 2
2: 8
3: 88
4: 404
Right 1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1003378866_1003378873 27 Left 1003378866 6:5604223-5604245 CCTCTGTCATCGCTCGTAGGATG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003378873 Original CRISPR ACTCCCATCTACACTCCTTG AGG Intronic
900691713 1:3984687-3984709 TCTCCCATCTAAACTGCTGGAGG + Intergenic
902668133 1:17953547-17953569 ACTCCCCTCTACTTCCCTTGGGG - Intergenic
904410509 1:30322168-30322190 ACTCCCATCTTCGCTCCTCAGGG + Intergenic
905336779 1:37250025-37250047 AGACCCACCTACATTCCTTGGGG + Intergenic
906694929 1:47817466-47817488 ACTCCCACCTCATCTCCTTGGGG + Intronic
913569449 1:120105511-120105533 ACTCCCACCTACAGTCAGTGAGG - Intergenic
914290261 1:146266498-146266520 ACTCCCACCTACAGTCAGTGAGG - Intergenic
914551304 1:148717281-148717303 ACTCCCACCTACAGTCAGTGAGG - Intergenic
916627227 1:166571531-166571553 ACTACCATGCACACTCCTTGAGG - Intergenic
916809101 1:168290073-168290095 AATCCCAGCTACTCTCCTGGAGG + Intronic
921971951 1:221159584-221159606 AATCACATCTATATTCCTTGGGG + Intergenic
1063863931 10:10343578-10343600 TATCCCATCAACACTGCTTGTGG - Intergenic
1072783498 10:98265891-98265913 GCTCCCCTCTCCACTCCCTGAGG + Intronic
1073099164 10:100998066-100998088 ACCCTCACCTCCACTCCTTGCGG + Intronic
1076439317 10:130469629-130469651 ACTGCCATCTCCACTCCCTCTGG + Intergenic
1077938326 11:6813746-6813768 ACTCCCACCTACACTTTCTGTGG + Intergenic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1084771122 11:71343541-71343563 GCTCCCATCCACCCTCCCTGCGG + Intergenic
1085350329 11:75794094-75794116 ACTCTCATCCCCACTGCTTGGGG - Intronic
1087281269 11:96213556-96213578 ACTGCCATCTACACTTCTTAAGG - Intronic
1087395781 11:97595934-97595956 ATTCATATCTACAATCCTTGTGG - Intergenic
1094039172 12:26104882-26104904 ATTCCCATATACACTTCATGTGG + Intergenic
1094577771 12:31703181-31703203 AATCCCAGCTCCACTCCTTTTGG - Intronic
1096646536 12:53040804-53040826 ACTCCCAACTACCCCCCTGGGGG - Exonic
1097176012 12:57143310-57143332 CCTCTCATCTACACTGCCTGGGG - Intronic
1101247317 12:102896288-102896310 ACTCTCATCAACCCACCTTGTGG - Intronic
1101598441 12:106188355-106188377 GCTTCCATTTACACTCCTTGGGG - Intergenic
1104786954 12:131456080-131456102 CCTCCCATCTCCAGACCTTGCGG - Intergenic
1110198458 13:72819052-72819074 ACTCACATCTGCACTCATTCTGG + Intronic
1114437140 14:22715386-22715408 ACGCCCATCTACCCTCCTGGAGG - Intergenic
1118265846 14:64294406-64294428 ACTCCCCTCTACCCTCCTCTCGG - Intronic
1120328232 14:83055446-83055468 CCTACCATCTTCACTCCTTCTGG + Intergenic
1125285756 15:38090803-38090825 ACTCCCTTCTCCACTGCTTTGGG + Intergenic
1129136657 15:73558691-73558713 ACTCTCATCTACACTGCTAGTGG + Intronic
1132576237 16:665719-665741 ACTCCCATCCTCACTGCATGTGG - Exonic
1132710123 16:1262763-1262785 ACTCCCACCTCCCCTCATTGGGG + Intergenic
1133923888 16:10179353-10179375 ACTCCCACCCACTCCCCTTGAGG + Intronic
1137920249 16:52480054-52480076 TCTCCCTGCTACAGTCCTTGGGG + Intronic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1140025285 16:71284016-71284038 ACTGCCTTCTACATTCATTGCGG - Exonic
1140650679 16:77084760-77084782 ACTCTCATCTACAATCACTGGGG - Intergenic
1141240645 16:82262193-82262215 ACTCCCCTGTCCACTCTTTGGGG + Intergenic
1141367806 16:83459809-83459831 ACTCCATTCTACACTTTTTGTGG - Intronic
1143359337 17:6355250-6355272 ACTCCCAACTACACTATTTCAGG + Intergenic
1143455655 17:7065931-7065953 ACTTCCACCCACGCTCCTTGGGG + Intergenic
1149199578 17:54167290-54167312 ACTCCCTTCCACACTGCATGGGG - Intergenic
1154172651 18:12062368-12062390 AGTCCCAGCTACTCTACTTGGGG - Intergenic
1155868180 18:30992573-30992595 ACTCCCACCCATATTCCTTGTGG + Exonic
1156261278 18:35446804-35446826 ACCCCCATTTACAAGCCTTGGGG - Intronic
1160855792 19:1217087-1217109 ACTCCCAGGTACACACCCTGAGG - Intronic
1161745883 19:6059636-6059658 ACTCTCATGTCCACTCCTGGGGG - Intronic
1161827078 19:6575199-6575221 ACTCCCACCTACTCTTCTTCTGG + Intergenic
1163233363 19:16018103-16018125 ACCCCCATCTCCACTCCTTCTGG - Intergenic
1163860515 19:19740402-19740424 ACCCCCATCTCCACTCCCTCTGG - Intergenic
1166541106 19:43606546-43606568 ACTCCCATGTAAGCTCCATGAGG + Intronic
932049652 2:68385892-68385914 ATGCCCTTTTACACTCCTTGAGG + Intronic
932376184 2:71238115-71238137 AGTCCCATATTCACACCTTGGGG - Intergenic
933037948 2:77424784-77424806 AATCACATATACACTCCTGGTGG + Intronic
933797302 2:85929843-85929865 TCTCCCATCAATGCTCCTTGGGG + Intergenic
936098223 2:109550677-109550699 ACTTCCATCTAAACTCTGTGTGG + Intronic
946107569 2:217385279-217385301 AATCTCACCTACACTCCTTTTGG - Intronic
1169633228 20:7657302-7657324 ACTCCCAGCTCCACTCATTCTGG - Intergenic
1170708248 20:18765672-18765694 ACCCCCACCTACACTCCTGAAGG + Intergenic
1174763869 20:53233284-53233306 TCTGCCATTTACACTCCATGAGG - Intronic
1175253950 20:57627573-57627595 ACTCCCATCATCACTCAGTGAGG + Intergenic
1175261092 20:57674577-57674599 AATCCCAGCTACACCCCTTTGGG + Intronic
1179148392 21:38789211-38789233 CCTCCCATATAAACTCCATGAGG + Intergenic
1182909642 22:33971544-33971566 ACACGCATCTTCACTCCTGGTGG - Intergenic
949302383 3:2599384-2599406 ATTGCCATCTCCAATCCTTGGGG + Intronic
949624571 3:5852005-5852027 GCTCCCATCTAGCCTCCTTTTGG + Intergenic
949741384 3:7238518-7238540 ACTAACATGTACACTCCTTTAGG + Intronic
950710463 3:14810165-14810187 CCTCCCGTCTACGCTCCATGAGG + Intergenic
953271765 3:41452387-41452409 ACTCCCATCTCCTCTCCTGGAGG - Intronic
955247543 3:57241057-57241079 ACTCCCATCTACTCTATTTCTGG - Intronic
960852529 3:122071025-122071047 ATTCCCATCTACTCCCTTTGTGG + Intronic
960966130 3:123105993-123106015 ACTCAAATCTCCACTCCCTGTGG - Intronic
961209533 3:125115040-125115062 ACTCCCTTCCACACTCCTTATGG - Intronic
962240547 3:133747528-133747550 TCTGTCATCTCCACTCCTTGTGG - Intronic
962844705 3:139264065-139264087 ACCCCCAACTCCATTCCTTGGGG + Intronic
966693061 3:182761407-182761429 ACTACCAACTCCATTCCTTGAGG + Intergenic
968826332 4:2900417-2900439 CCTCACATCTACACCACTTGAGG - Intronic
969876423 4:10138897-10138919 TATCACATCTACACTCCATGTGG + Intergenic
974896233 4:67942616-67942638 ACGCCCATCTACAATGCATGAGG - Intronic
977177926 4:93838526-93838548 ACTCCCTGCTTCACTCCTTGGGG - Intergenic
977238118 4:94533345-94533367 ACTTCAATCTATACTCCTTTGGG + Intronic
978363305 4:107954030-107954052 TCTCTCATCTCCACTCCATGAGG + Intergenic
979121654 4:116910084-116910106 ACCCCCATCTCTTCTCCTTGTGG - Intergenic
979690359 4:123552745-123552767 ATTCCCATCTCCACTCGTGGGGG - Intergenic
984610309 4:181829760-181829782 ACTCCCATCAGCACTGCTGGAGG - Intergenic
985718407 5:1475787-1475809 CCTCCCATCTCCACTCCGAGTGG + Intronic
985718428 5:1475855-1475877 CCTCCCATCTCCACTCCGAGTGG + Intronic
985792391 5:1937142-1937164 ACGCCCATCAGCACACCTTGGGG + Intergenic
986345125 5:6827581-6827603 TCTCCCATCTTCCCTCCTTCAGG - Intergenic
988837179 5:35044863-35044885 CCTCCCATCTACACCCCTCCAGG - Intronic
991135525 5:63177482-63177504 ACTACAGTCTACAATCCTTGGGG - Intergenic
993671381 5:90765013-90765035 ACTCCCACCTACTTTCCATGGGG + Intronic
995133064 5:108650500-108650522 ACCCCCAGCCACACTCCTTTTGG - Intergenic
1003378873 6:5604273-5604295 ACTCCCATCTACACTCCTTGAGG + Intronic
1003398578 6:5773571-5773593 ATTCCCCTCAACACTCCATGAGG + Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1006639662 6:35483430-35483452 ACTCCCATCCACTCCCCTTCAGG + Intronic
1006764495 6:36492929-36492951 CCTCCCTTCTGGACTCCTTGAGG + Intergenic
1007075766 6:39065235-39065257 CCTCCCTCCCACACTCCTTGGGG - Intronic
1010164018 6:72894243-72894265 ACTCACCTCTACACTTCTTGTGG + Intronic
1017078804 6:150646476-150646498 ACATCCATCTACCCTCCTTCTGG - Intronic
1018641879 6:165911540-165911562 ACTCCCATCTACACTGTCTCTGG + Intronic
1018698796 6:166411391-166411413 CCTCCCATCTAGTCTGCTTGGGG + Exonic
1018896337 6:168020400-168020422 AATCCGTTGTACACTCCTTGTGG - Intronic
1021809490 7:24389709-24389731 ACACTCATCTACACACCTTCAGG + Intergenic
1021845441 7:24758003-24758025 ACTCCACTCTAAGCTCCTTGAGG + Exonic
1022374719 7:29802762-29802784 TCCCCCATCAACCCTCCTTGAGG - Intergenic
1027349898 7:77300797-77300819 AATCCCACCTACACTGCTGGTGG - Intronic
1029959060 7:104670158-104670180 ACTCCCAACTAACCCCCTTGGGG - Intronic
1033798315 7:144873374-144873396 TCTCCCACTTCCACTCCTTGAGG + Intergenic
1034091436 7:148367863-148367885 ACTTCCATCTACACTTCAGGAGG - Intronic
1034753424 7:153592064-153592086 ACACCCACCTACACTCCATCAGG - Intergenic
1035385419 7:158469089-158469111 ACACCCATGCACACTCCTGGTGG + Intronic
1038268052 8:26051054-26051076 ACCCCCATCTGCTCTCCTTTGGG - Intergenic
1040089129 8:43378470-43378492 ACTCCCTCTTACACTCCTAGAGG - Intergenic
1041772859 8:61490837-61490859 AATCCCAGCTACTCTACTTGAGG + Intronic
1042065696 8:64873225-64873247 ACTGCCATCTAAACTCCATATGG - Intergenic
1045321546 8:101085589-101085611 ACTCCAATCTACATTCCTGCTGG + Intergenic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1046426488 8:114058592-114058614 ACTCCTATGTACATTTCTTGTGG + Intergenic
1050883619 9:10736634-10736656 ACTCCCATCAACATTGCTTGAGG - Intergenic
1059641513 9:116221186-116221208 TCCCCCATATAAACTCCTTGAGG + Intronic
1059911799 9:119052844-119052866 ACTTCAATCTAAACTCCTAGGGG - Intergenic
1186461916 X:9754646-9754668 ACTCCCAAATACTATCCTTGGGG + Intronic
1187875823 X:23803303-23803325 ACTCCCACCTATACTCTTAGGGG + Intergenic
1188561774 X:31476650-31476672 ATTCCAATCCAAACTCCTTGCGG - Intronic
1188813915 X:34687545-34687567 ACTCCCATCAACAGTCTGTGAGG + Intergenic
1192079557 X:68033472-68033494 ACGCCCATGTATACTGCTTGGGG + Intergenic
1192087202 X:68112411-68112433 ATTCCCATCCACCTTCCTTGTGG + Intronic
1193058042 X:77175563-77175585 TCACTCATCTACACTCCTTTTGG + Intergenic
1193932345 X:87569352-87569374 ATTCCCATCAACAATACTTGAGG - Intronic
1195264289 X:103164761-103164783 ACACCCATCTCCACCCTTTGGGG - Intergenic
1196079776 X:111619070-111619092 ACTCCCAACTACCCCCCTGGGGG + Intergenic
1201447750 Y:14076882-14076904 CTTCCAGTCTACACTCCTTGTGG - Intergenic