ID: 1003380480

View in Genome Browser
Species Human (GRCh38)
Location 6:5620460-5620482
Sequence TGTTCAAATGTAGGACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003380475_1003380480 0 Left 1003380475 6:5620437-5620459 CCCAAGGAACAGAGAGACCCACT 0: 1
1: 0
2: 1
3: 27
4: 302
Right 1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1003380476_1003380480 -1 Left 1003380476 6:5620438-5620460 CCAAGGAACAGAGAGACCCACTT 0: 1
1: 0
2: 2
3: 19
4: 230
Right 1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003380480 Original CRISPR TGTTCAAATGTAGGACAAGC TGG Intronic
902777617 1:18684772-18684794 TGTTAAACTGTAAGAAAAGCTGG + Intronic
908042911 1:60134667-60134689 TGCTTAAATCTAGGACAAGGAGG - Intergenic
910206642 1:84754836-84754858 TTTTCATATGAAGGACAAGATGG - Intergenic
919816399 1:201443507-201443529 TGTTAAAATGCAGGAAAAGTGGG + Intergenic
923946213 1:238890462-238890484 TGTAAAAATGTAGGTGAAGCAGG + Intergenic
924473203 1:244361523-244361545 TTTTGAAATGTAGAACAGGCCGG - Intronic
924762992 1:247006776-247006798 TTTTCAAATGTATGGCAAGCAGG - Intronic
924778594 1:247127970-247127992 TTTCCAAATGTAAGGCAAGCAGG + Intronic
1063422279 10:5922848-5922870 TGTTAAAATGTAGAATAATCTGG + Intronic
1066005378 10:31141874-31141896 TTCACAAATGTAGGAAAAGCTGG - Intergenic
1073623068 10:105068983-105069005 TGTTCACATGTAAGAAAATCAGG - Intronic
1074245053 10:111681235-111681257 TGGTCAAGTGTTGGTCAAGCTGG + Intergenic
1076030043 10:127149634-127149656 TGTTTAAATGCAAGACAGGCAGG + Intronic
1077454178 11:2668031-2668053 AGTTCAAATGTGGGCAAAGCTGG - Intronic
1078746602 11:14121379-14121401 TGTTCAAATGTGGGAATAGAGGG + Intronic
1079865472 11:25728734-25728756 TGTTTAACTGTAGTACAAGTTGG + Intergenic
1080205701 11:29726270-29726292 TTTTACAATGTAGGACAGGCAGG - Intergenic
1081406201 11:42701251-42701273 TATGCAAATGTGGGAGAAGCTGG - Intergenic
1081651131 11:44824777-44824799 TGTTCAATTTTGGGAGAAGCCGG + Intronic
1082055844 11:47815511-47815533 GATTCAAATGTAGGGCAAGAGGG + Exonic
1085668923 11:78443023-78443045 GATAAAAATGTAGGACAAGCTGG + Intronic
1088186045 11:107171621-107171643 TGTTCAAATGGATGCCAAGTGGG - Intergenic
1088584220 11:111346564-111346586 TATTCAAATATGGGGCAAGCTGG - Intergenic
1089552250 11:119289005-119289027 TTTTCAAATGTATGAAAATCAGG - Intronic
1089958392 11:122593944-122593966 TGTATAAATGAATGACAAGCAGG + Intergenic
1091486590 12:895157-895179 TGCTCACATGTTGGACAACCTGG - Intronic
1092134669 12:6138353-6138375 GGTTCAAAGGCAGGAAAAGCGGG - Intergenic
1092551618 12:9508391-9508413 TGTCCAAGTGTAGTACAGGCTGG + Intergenic
1093733338 12:22590584-22590606 TATGCAAATGTAAGACAAGCAGG - Intergenic
1097595754 12:61627542-61627564 GTTTCACATGTTGGACAAGCTGG - Intergenic
1098450406 12:70612485-70612507 TGTCCTTATGTAGGACAAGCAGG - Intronic
1098893585 12:76032622-76032644 TGTTTAAATGTAGGAGTAGGAGG - Exonic
1107403477 13:40091783-40091805 TTTGCAAATGTAGGAAAAGGAGG - Intergenic
1109138663 13:58684685-58684707 TATTCAAATGGAGGGTAAGCAGG - Intergenic
1116038171 14:39654593-39654615 TGTACAAATATAGGAAAAGTTGG + Intergenic
1116529238 14:45947260-45947282 TGTTAAAATGTAAGCCAAGTGGG - Intergenic
1118365606 14:65093056-65093078 TTTTCAAATGTAGAAACAGCTGG + Intronic
1120059985 14:79971175-79971197 AGTTCAAATGTAGGACATTGTGG + Intergenic
1122255898 14:100476212-100476234 TGTTCAGATGCAGGCCCAGCTGG + Intronic
1124423790 15:29545111-29545133 TGTTCGAAGTCAGGACAAGCTGG + Intronic
1127539835 15:59926363-59926385 TGTTAACATTTAGGAGAAGCGGG + Intergenic
1127713504 15:61624826-61624848 TGTCCAAATGGAGGAGAAGGTGG + Intergenic
1130292264 15:82613545-82613567 TGTACAAAAGTATGAAAAGCCGG - Intronic
1134177708 16:12021589-12021611 TCTTGAAATATAGGACAGGCTGG + Intronic
1139115165 16:63942370-63942392 TTTTCAAATGTAGAAAAACCAGG - Intergenic
1140297506 16:73723754-73723776 TCTTCAAATGTAGGATAAACTGG + Intergenic
1142268381 16:89076757-89076779 TGCTCACAGGTAGCACAAGCAGG - Intergenic
1146611357 17:34307894-34307916 TGTTTAGCTGTAGGACAGGCAGG - Intergenic
1149015776 17:51906842-51906864 GTTTCAAACGTAGGGCAAGCAGG - Intronic
1149138750 17:53403735-53403757 TATTGAAATGTAGGATATGCTGG - Intergenic
1150091269 17:62327483-62327505 TGTTCTATTGTAGAACAAGATGG + Intergenic
1153155639 18:2145994-2146016 TGTTCAACTGGAGGGCTAGCAGG - Intergenic
1153291662 18:3507694-3507716 TGCTCAATTGTTGGTCAAGCTGG - Intronic
1155719922 18:28999148-28999170 TGTTCAAAAGCATGACAAGGAGG + Intergenic
1156371809 18:36477770-36477792 GGTACAAATGTATGACAAGTGGG + Intronic
1159912396 18:74158552-74158574 TGTTCAAAAGAAAGACAAGAAGG + Exonic
1161599711 19:5174181-5174203 TCATCAGCTGTAGGACAAGCTGG - Intronic
1162348350 19:10134385-10134407 TGCTCAGATGGAGGACAACCTGG + Intronic
1164260857 19:23567795-23567817 CTTTCTAATGTATGACAAGCAGG - Intronic
1165105516 19:33467585-33467607 GGCTCAAATGTAGGACAAGAAGG + Intronic
1165645065 19:37428866-37428888 TGTTCCCATGTTGGCCAAGCTGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166879101 19:45916239-45916261 TTTTGACATGTTGGACAAGCTGG + Intergenic
929859094 2:45660478-45660500 TCTGCAAATGGAGGACAAGTGGG - Intronic
930390448 2:50754754-50754776 TGCTTAAAAGTAGAACAAGCTGG - Intronic
931033813 2:58214278-58214300 TGTTCTAATGTAGGAGAAAAAGG - Intronic
931249667 2:60518799-60518821 TGTTCAAGTTCAGGTCAAGCTGG + Intronic
931492224 2:62760639-62760661 TGATCAAAAGTGGGAAAAGCAGG - Intronic
932792244 2:74663960-74663982 TGTTCAAAAGAAGTACTAGCAGG - Intronic
934864369 2:97792725-97792747 TGTTCGAATCTAAGACAAGGGGG + Exonic
937825127 2:126360509-126360531 TGTACCAATCTAGTACAAGCTGG - Intergenic
941739464 2:169017982-169018004 AGAACAAAAGTAGGACAAGCTGG - Intronic
942829484 2:180222771-180222793 TGCACAATTGTAGGAGAAGCTGG + Intergenic
943891605 2:193294653-193294675 TGTTCAAATGGAGGAACAGCTGG - Intergenic
946483746 2:220080952-220080974 TGTTAAAATGGAGGAAATGCAGG + Intergenic
947581199 2:231319748-231319770 TGGCCACATGCAGGACAAGCTGG - Intronic
948066135 2:235081826-235081848 TTTTCCCATGTTGGACAAGCTGG - Intergenic
1169670734 20:8098472-8098494 TGTTTTAATGTAGGGCAAGCAGG - Intergenic
1169910175 20:10641769-10641791 TGCTCAAAGGTAGGACATGATGG - Exonic
1170139424 20:13110906-13110928 TGTTCAACTTTAAGACAAGGAGG + Intronic
1177148369 21:17430349-17430371 TGTTCCACTGAAGGACAAGGAGG - Intergenic
1177848440 21:26318659-26318681 TGTTTAGATATAGGACAAGGTGG + Intergenic
1178977381 21:37231569-37231591 GGATCAAGTGAAGGACAAGCTGG - Intronic
1180844819 22:18975285-18975307 TGGTCAAATGTGGGACCTGCTGG + Intergenic
1181056649 22:20263427-20263449 TGGTCAAATGTGGGACCTGCTGG - Intronic
1184506701 22:44908013-44908035 TGTTTATATGCAGGAAAAGCTGG + Intronic
949862623 3:8520472-8520494 TGTTCTAATTTAGGAAAGGCAGG + Intronic
952325375 3:32315688-32315710 TGGTCAAATCTGGGAAAAGCTGG - Intronic
955012428 3:55031346-55031368 TGAACAAATGGAGGGCAAGCTGG - Intronic
958788620 3:98625925-98625947 TGGTCAAATGTAAGAAAAGGGGG - Intergenic
960615694 3:119594021-119594043 TGTTCACATGCAGGACATACAGG + Intergenic
962890186 3:139665070-139665092 TGTTCAAAAATAGCACCAGCAGG - Intronic
965302653 3:167021550-167021572 TTTTAAAATGTATGACAAGATGG + Intergenic
970655665 4:18228002-18228024 TGTTCATATGGCTGACAAGCTGG - Intergenic
971952005 4:33363463-33363485 TTTTCAAAAATAGGACATGCTGG - Intergenic
973955059 4:56055294-56055316 TATTTAAATCTAGGATAAGCCGG + Intergenic
981208761 4:142075628-142075650 TGTTCTAAGGAAGAACAAGCAGG + Intronic
981441460 4:144787739-144787761 TGTTCAAATGTATCACATTCAGG + Intergenic
981848598 4:149200270-149200292 TGTTAAAATGTAGCACATACTGG - Intergenic
982842606 4:160210529-160210551 TGCTCACATGTAGGACAAAGAGG - Intergenic
987668019 5:20970033-20970055 TGTTAATGTGTAGGACAAACTGG - Intergenic
988329829 5:29821386-29821408 GTTTCAAATGTTGGTCAAGCTGG + Intergenic
988601158 5:32640653-32640675 TGTTCATATGTTTGCCAAGCGGG - Intergenic
990723493 5:58726240-58726262 TTTTTAAATGAAGCACAAGCGGG - Intronic
991245914 5:64507707-64507729 TGTTGAACTCTTGGACAAGCTGG - Exonic
991294741 5:65068771-65068793 GATTCAAATGGAGGACAAGAGGG - Intergenic
992500370 5:77336619-77336641 TGTTCAAATGTTGGACATTTGGG + Intronic
992766447 5:80005273-80005295 TTTGCAAATGTATGAAAAGCTGG - Intronic
993250562 5:85515764-85515786 TGTGCATATTTAGGACAAGGTGG - Intergenic
993573319 5:89569733-89569755 TGTTCTCATGTGGGAGAAGCAGG - Intergenic
993651317 5:90526111-90526133 AGTTGAAATGCAGAACAAGCTGG - Intronic
1001388596 5:171360159-171360181 TTTTAAAATGTAGAACAGGCTGG + Intergenic
1003125578 6:3353259-3353281 TGTTCAAATGCTGGAAAACCAGG - Intronic
1003380480 6:5620460-5620482 TGTTCAAATGTAGGACAAGCTGG + Intronic
1005527720 6:26667614-26667636 AGTTCAAATGTAGGAGGAGAGGG + Intergenic
1005543075 6:26834064-26834086 AGTTCAAATGTAGGAGGAGAGGG - Intergenic
1007318663 6:41010398-41010420 TGTTCAAAGGAAGGAGAAGATGG - Intergenic
1008157884 6:48039321-48039343 TGTTCAAAAATAGGAAAAACAGG + Intronic
1008259232 6:49344270-49344292 TGTTCACATTTAGGAGAAGGGGG + Intergenic
1008955857 6:57214609-57214631 TGTTTCAATGGAAGACAAGCAGG + Intronic
1009013893 6:57876234-57876256 AGTTCAAATGTAGGAGGAGAGGG - Intergenic
1010181222 6:73088419-73088441 TTTTCAAAAGTAGAACAATCGGG - Intronic
1011994067 6:93562956-93562978 TGTTCACATGAAGGCCTAGCTGG - Intergenic
1012139123 6:95599530-95599552 TATTCTAATGGAGGACAATCTGG + Intronic
1012257480 6:97050528-97050550 TGCTCAGATGTAAGGCAAGCAGG + Intronic
1017864502 6:158431468-158431490 TGTGCACATGTAGGACAGGCAGG + Intronic
1018328611 6:162703503-162703525 AGTTGAAATGTAACACAAGCCGG + Intronic
1023056492 7:36294600-36294622 TTTTTAAATGTAGTACAATCTGG - Intronic
1024640872 7:51327461-51327483 TATGCAAATGTCGGACAAGCAGG - Intergenic
1025247486 7:57328264-57328286 TGCACAAATGGAGGACATGCAGG + Intergenic
1025636478 7:63324329-63324351 TTTTCAAATGTATGGCAAGCAGG + Intergenic
1025646218 7:63423773-63423795 TTTTCAAATGTATGGCAAGCAGG - Intergenic
1025724865 7:64047137-64047159 TTTTCAAATGTTTGGCAAGCAGG + Intronic
1025753900 7:64315692-64315714 TTTTCAAATGTTTGGCAAGCAGG + Intronic
1030945226 7:115710895-115710917 TGTTCAATTGCAGGGCATGCTGG - Intergenic
1031176639 7:118361224-118361246 TGTTCAAATGTATAACTAGACGG + Intergenic
1036031424 8:4978247-4978269 TGTTCAAAGGGGGGACAGGCAGG + Intronic
1036387338 8:8293986-8294008 GGGTCAAATCAAGGACAAGCAGG + Intergenic
1042525989 8:69765676-69765698 AGTTCAAGTGCAGGACAAACCGG + Intronic
1046862221 8:119106263-119106285 AGATCAAATGTAGTACAATCAGG - Exonic
1047628725 8:126682805-126682827 TGTTCAAAGGTGGGGCCAGCTGG - Intergenic
1052087418 9:24284534-24284556 TGTTCACATGTAGTAGATGCTGG + Intergenic
1055388942 9:75797480-75797502 TGTACAAATGTGGGAGGAGCTGG - Intergenic
1055825052 9:80313684-80313706 TGTCCAAATGTGGGACAATGTGG - Intergenic
1056680986 9:88718547-88718569 AGTTAAAAAGTAGAACAAGCGGG - Intergenic
1057887179 9:98838692-98838714 TATGCAAATGCAGGGCAAGCAGG - Intronic
1061058675 9:128239374-128239396 TTTTAAAATGCAGGGCAAGCTGG - Intronic
1061891560 9:133623926-133623948 TGTACAAATGTGGGAAAGGCTGG + Intergenic
1186396650 X:9215670-9215692 TTTTCAAATGAAGGAAATGCTGG + Intergenic
1188083491 X:25874859-25874881 AGTTCAACTGTAGGACTAGAGGG - Intergenic
1194725919 X:97397179-97397201 TGTTGATATATATGACAAGCAGG - Intronic
1195470097 X:105220554-105220576 TGTCCTAGGGTAGGACAAGCCGG - Intronic
1195732738 X:107982269-107982291 TGTCCTAGGGTAGGACAAGCCGG - Intronic
1200429879 Y:3066856-3066878 TGTTCAGATTTATGTCAAGCAGG + Intergenic