ID: 1003384215

View in Genome Browser
Species Human (GRCh38)
Location 6:5652529-5652551
Sequence GCAGAAATGAAGGCCCAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 9, 3: 75, 4: 529}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003384208_1003384215 11 Left 1003384208 6:5652495-5652517 CCTTTTTCTTTCAAAGGACAAGT 0: 1
1: 0
2: 4
3: 43
4: 586
Right 1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG 0: 1
1: 0
2: 9
3: 75
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003384215 Original CRISPR GCAGAAATGAAGGCCCAGTG CGG Intronic
900347395 1:2216253-2216275 GCTGAATTGAAGAGCCAGTGTGG - Intergenic
900512209 1:3066171-3066193 GGGCAAATGTAGGCCCAGTGGGG - Intergenic
900551920 1:3260983-3261005 GCAGAAAACAAGGCCCTGAGAGG - Intronic
901223046 1:7594804-7594826 TCAGAAAGGGAGGCCCAGCGGGG + Intronic
901858094 1:12057070-12057092 GAAGAAATGGAGGCTCAGAGAGG + Intergenic
901873537 1:12152699-12152721 GAAGAAATGGAGGCTCAGGGAGG + Intergenic
902527663 1:17069919-17069941 GAGGAAATGGAGGCCCAGAGAGG + Intronic
902830092 1:19006950-19006972 GGAAAAATGGAGGCCCAGAGAGG + Intergenic
902938671 1:19783806-19783828 GGAGAAACGGAGGCCCAGAGAGG + Intronic
903365303 1:22802206-22802228 GGGGAAATGATGGCCCAGTTGGG + Intronic
903367859 1:22816034-22816056 GGGGAAAAGAAGGCCCAGAGAGG - Intronic
903580449 1:24366747-24366769 AGAGAAATGAAGACCCAGAGAGG + Intronic
903693668 1:25192317-25192339 GAAAAAATGAAGGGCCAGAGAGG + Intergenic
904368577 1:30034266-30034288 GAAGAAATGAAGACTCAGAGAGG - Intergenic
904785415 1:32978919-32978941 GATGAAATTAAGGCCCAGAGAGG + Intergenic
905069274 1:35211016-35211038 GCTGAAATGATGGCCCAAAGGGG - Intergenic
905257247 1:36692891-36692913 GCATAATTGATGGCGCAGTGAGG + Intergenic
905275206 1:36813199-36813221 GACGAAAGGAAGGCCCAGAGAGG - Intronic
906312381 1:44763102-44763124 GCAAAAACTGAGGCCCAGTGAGG - Intronic
906546006 1:46619909-46619931 GTAGAAACTAAGGCCCAGAGAGG - Intergenic
906642309 1:47448918-47448940 AGAGAAATGGAGGCCCAGTGGGG - Intergenic
907626882 1:56039181-56039203 GTAGAAACTAAAGCCCAGTGAGG - Intergenic
907683960 1:56591560-56591582 GAATGAATGAAGGACCAGTGGGG + Intronic
907943196 1:59108520-59108542 GGAGAAATGAAGGCTCAGAGAGG + Intergenic
908383960 1:63622943-63622965 TCAGAGATGAATGCCCAGAGAGG + Intronic
909385511 1:75051111-75051133 GAAGAAATTAAGGTCCAGAGAGG - Intergenic
910368560 1:86491910-86491932 GGAGAAATGAAGGTCCACAGAGG - Intronic
910728562 1:90364405-90364427 GGAGAAATGAAAGCCCAGAATGG + Intergenic
911144361 1:94538499-94538521 GCAGAGAGGAAGGCCAACTGAGG + Intronic
911267374 1:95758727-95758749 GCAGAAACCAAGGCCCAAAGTGG + Intergenic
911401194 1:97377794-97377816 GGAGCCATGAGGGCCCAGTGTGG + Intronic
912525541 1:110280184-110280206 GCAGAAATCGAGGCACAGAGAGG + Intronic
912655183 1:111480213-111480235 ACAGAAATGGAGGCACAGAGAGG + Intergenic
912947636 1:114097923-114097945 TCAGAAAAGGAGGTCCAGTGTGG + Intronic
913403580 1:118462917-118462939 GTAGAAATTGAGGCCCAGAGAGG - Intergenic
914215956 1:145628563-145628585 GAAGAAATGGAGGCACAGAGAGG - Intronic
914374336 1:147060426-147060448 GCTGAAAAGAGGGCCCGGTGTGG - Intergenic
914468525 1:147951190-147951212 GAAGAAATGGAGGCACAGAGAGG - Intronic
914676637 1:149911371-149911393 GCAAAAGTGAAGGGGCAGTGCGG + Intronic
914842485 1:151259906-151259928 GAAGAAATGAGGGCCAAGTGTGG + Intronic
915902593 1:159857115-159857137 GAAGAAATTAAGGCACAGGGAGG + Intronic
917662674 1:177192820-177192842 GCAGAAATGAATACGCAGTCAGG + Intronic
917740274 1:177955203-177955225 AGAGAAATGCAGGCCCGGTGCGG + Intronic
919799417 1:201344455-201344477 GGAGAAGGGAAGGCCCAGGGAGG - Intergenic
920492572 1:206428634-206428656 GAAGAAATGAAGGCTTAGTGAGG - Intronic
920607457 1:207402570-207402592 GGATAAAATAAGGCCCAGTGCGG - Intergenic
920767465 1:208847188-208847210 GAAGAAATGAAGGGACAATGAGG + Intergenic
921278152 1:213539499-213539521 GCAGAATTGAGAGCCCAGTCTGG - Intergenic
922292964 1:224224122-224224144 TCAGAACTTAATGCCCAGTGTGG - Intergenic
923536748 1:234858319-234858341 GAAGAAATGAAGGCTCAGGAGGG - Intergenic
924077328 1:240353886-240353908 GGAGAAAAGCAGGCCCTGTGGGG + Intronic
924931641 1:248737635-248737657 GGAGAAACTAAGGCCCAGAGAGG + Intronic
1063582859 10:7324925-7324947 GAAGTAATTAAGGCTCAGTGAGG - Intronic
1064345245 10:14526464-14526486 GCTGAAATTCAGGCCCAGCGCGG - Intronic
1064644340 10:17445643-17445665 ACAGAAATGAAGGGGCACTGGGG - Intronic
1065432855 10:25676884-25676906 GGAGAAATGGAGGCACAGAGAGG - Intergenic
1065850282 10:29782068-29782090 ACAGAAATTAAGGCCGGGTGCGG + Intergenic
1066216643 10:33294784-33294806 GAGGAAACGAAGGCCCAGAGAGG - Intronic
1066981558 10:42421221-42421243 GCAGACATGCAGGCCCAGTGTGG + Intergenic
1068632732 10:59314398-59314420 GAAGAAATCAAAGCCCAGAGAGG + Intronic
1068891851 10:62156180-62156202 GGGAAAATGGAGGCCCAGTGAGG + Intergenic
1069582545 10:69575494-69575516 GAAAAAATCAAGGCCCAGAGAGG + Intergenic
1069602129 10:69714737-69714759 GCAGAGATGGAGGCACAGAGAGG + Intergenic
1069903225 10:71717715-71717737 GCCGGAGTGCAGGCCCAGTGTGG + Intronic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1070320561 10:75351866-75351888 GAAGAACTGGAGGCCCAGAGAGG - Intergenic
1070542447 10:77425888-77425910 TCAGAAACCAAGGCCCTGTGTGG - Intronic
1070683289 10:78464251-78464273 GAAGAAATTAAGGCACAGAGAGG + Intergenic
1070767532 10:79065401-79065423 GCAGATCTCCAGGCCCAGTGAGG + Intergenic
1071574210 10:86714172-86714194 GAAGAAATTGAGGCCCAGAGAGG + Intronic
1071729414 10:88233003-88233025 GCAGAAACGGAGGCCCAGAGAGG + Intergenic
1072696665 10:97609117-97609139 GCAGAAACGAGGGCCCCGTTGGG + Intronic
1072758563 10:98037406-98037428 ACATAAATGAAGGCTCAGAGAGG + Intergenic
1073286489 10:102392765-102392787 GAAGAAATTAAGGCTCAGAGAGG - Intergenic
1073538351 10:104297867-104297889 GCAGAAATGCGGGCAAAGTGTGG - Intronic
1073901168 10:108222600-108222622 GAGGAACTTAAGGCCCAGTGTGG + Intergenic
1074457505 10:113608236-113608258 GAGGAAATGAAAGCCCAGTTGGG - Intronic
1074781561 10:116806041-116806063 GCAGAGATGAAAACCCAGTGTGG + Intergenic
1074931226 10:118128176-118128198 GCAGAAATGCAGGGGCACTGGGG - Intergenic
1075068559 10:119305916-119305938 GCAGAAAATAACTCCCAGTGAGG + Intronic
1075803974 10:125172060-125172082 GAAGAAAAGGAGGCCCAGAGAGG - Intergenic
1077661407 11:4071782-4071804 GGGGAAATGAAGGCTCAGAGAGG + Intronic
1077866616 11:6227287-6227309 GAGGAAATCAAGGCCCAGAGAGG + Intronic
1078088773 11:8251089-8251111 GCAGAAAGGAACTCCCAGTGAGG - Intronic
1078216160 11:9313955-9313977 GAAGAAACTGAGGCCCAGTGTGG - Intronic
1078520182 11:12056735-12056757 AAAGAAATGGAGGCCCAGGGAGG + Intergenic
1078857168 11:15215586-15215608 GAGGAAATGGAGGCCCAGGGAGG - Intronic
1078901422 11:15646166-15646188 GCAGAAATGGAGGCGCAGAGAGG + Intergenic
1079106899 11:17577586-17577608 GAGGAAATGAAGGCCCAGAGAGG - Intronic
1080774203 11:35370664-35370686 GCAGAGAGGAGGGCTCAGTGCGG + Intronic
1081776536 11:45679343-45679365 GCGGACCTGCAGGCCCAGTGGGG - Intergenic
1081869199 11:46375680-46375702 GGGGAAATCAAGGCCCAGAGAGG - Intronic
1082027058 11:47580236-47580258 GCAGAAATGCAGGCAATGTGAGG + Intronic
1083018840 11:59485304-59485326 GCAGAAATGGAGGCTGGGTGCGG - Intergenic
1083116643 11:60466297-60466319 GAAGAAATTGAGGCACAGTGTGG - Intronic
1083295265 11:61711873-61711895 GAAGAAATGGAGGCCCAGAGAGG - Intronic
1083613747 11:64016421-64016443 GCAGAGCTGAAGGCCCTGTCTGG - Intronic
1084047396 11:66577307-66577329 AAAAAAAAGAAGGCCCAGTGTGG - Intergenic
1084309381 11:68307937-68307959 GCAGAAACTGAGGCCCAGAGAGG + Intergenic
1085011626 11:73145295-73145317 GGAGAACTGGAGGCTCAGTGGGG + Intergenic
1085245455 11:75097375-75097397 GACAAAATGAAGACCCAGTGAGG - Intergenic
1085255109 11:75168223-75168245 GAAGAAACCAAGGCCCAGAGTGG + Intronic
1085301426 11:75461139-75461161 GGGGAAATGGAGGCCCAGAGAGG - Intronic
1086854915 11:91854679-91854701 GAAGAAATCAAGGCACAGAGAGG + Intergenic
1086987893 11:93269927-93269949 GAAGAAATGAAGGCTCAGGAAGG + Intergenic
1087078193 11:94144848-94144870 GGAGAAATAAAGGCTCAGAGAGG - Intronic
1087883890 11:103454490-103454512 GAGGAAGTGGAGGCCCAGTGAGG - Intronic
1089155341 11:116397751-116397773 GCAGAAACGAAGGCCAAGTTTGG - Intergenic
1090416823 11:126546280-126546302 TGGGAAATGGAGGCCCAGTGAGG + Intronic
1090495885 11:127211597-127211619 GCAGATATGAAGGCCGATAGAGG - Intergenic
1090606011 11:128423494-128423516 GAAGAAATGTAGGCTCAGAGAGG + Intergenic
1091283696 11:134396545-134396567 GGGAAAATGAAGGCCCAGAGAGG - Intronic
1091899431 12:4133204-4133226 CCAGCAAGGAAGGCCCAGTGAGG + Intergenic
1092074255 12:5659994-5660016 GCAGACAAGAAGGCTCAGAGAGG - Intronic
1092326949 12:7542782-7542804 ACAGAACTGAAGGCCAGGTGAGG + Intergenic
1093130837 12:15390231-15390253 GCATGAATGAAGGCCAAATGTGG + Intronic
1093452708 12:19333897-19333919 GAATAAATGAAGGCCAGGTGCGG - Intronic
1093661868 12:21766609-21766631 GCAGAAGTGAAAGACCTGTGAGG + Exonic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1096532826 12:52252708-52252730 GCAGAAATGCAGGTCCAGTGTGG - Intronic
1096798110 12:54091149-54091171 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1096808307 12:54153983-54154005 GAAGAAACTAAGGCCCAGAGAGG - Intergenic
1096814489 12:54193333-54193355 ACAGAAATGCAGAGCCAGTGGGG + Intergenic
1097039523 12:56147133-56147155 GCAGAAAGGAAGGGGCAATGAGG - Intergenic
1097513391 12:60571605-60571627 ACAGTAATTAAGGCCCAGCGCGG + Intergenic
1097712466 12:62932247-62932269 GCGGAAATGGAGGCCCAGAGAGG + Intronic
1098071344 12:66679000-66679022 GGAGAAAGGTAGTCCCAGTGGGG + Intronic
1098984947 12:77001951-77001973 GCAGAAGGGAAAGCCCAGTGGGG + Intergenic
1099438135 12:82668162-82668184 GAAGAAATGGAGGTCAAGTGAGG - Intergenic
1101430875 12:104626020-104626042 GAGGAAATCGAGGCCCAGTGAGG + Intronic
1101477199 12:105062248-105062270 GCAGAAAGGGAGGCTCAATGAGG + Intronic
1101700267 12:107167371-107167393 GCAGAAACAAAGGCACAGAGTGG + Intergenic
1102030283 12:109736400-109736422 GCAGAAACTAAGGCTCAGAGAGG + Intronic
1102274978 12:111574936-111574958 GAGGAAATGAAGGCCCAGAGAGG - Intronic
1102383635 12:112488186-112488208 GCAGAAATTAAGGGTCAGAGAGG + Intronic
1102584877 12:113915718-113915740 GAAGAAATGGAGGCCCAGAGCGG - Intronic
1102596370 12:113995829-113995851 GTATAAATAAATGCCCAGTGAGG + Intergenic
1103358634 12:120340802-120340824 AAAGAAATGAAGGCAGAGTGTGG - Intergenic
1103598646 12:122040135-122040157 GGAGAAACTAAGGCCCAGTGAGG + Intronic
1103981420 12:124739285-124739307 GCGGAAATGGAGGGCCAGAGAGG + Intergenic
1104353606 12:128066279-128066301 TCAGAAAAGAAGGCCAGGTGAGG + Intergenic
1104699511 12:130891426-130891448 ACATAAATCAAGGCCAAGTGTGG - Intergenic
1104703378 12:130924258-130924280 GCAGAAATGAGGACTCAGTTTGG - Intergenic
1104761075 12:131297836-131297858 GCAGAAAGGCAGGCCTGGTGCGG + Intergenic
1104818702 12:131662956-131662978 GCAGAAAGGCAGGCCTGGTGCGG - Intergenic
1105202347 13:18191183-18191205 GCAGCTCAGAAGGCCCAGTGTGG - Intergenic
1105291888 13:19058599-19058621 GCTGCAATGAAGGCCCAGGACGG + Intergenic
1105776673 13:23668688-23668710 GCAGAAACGCAGGCCCAGCCGGG + Exonic
1105890025 13:24676132-24676154 GAAGAAATGAGGACACAGTGTGG + Intergenic
1106412612 13:29521504-29521526 GTAGAAGTGGAGGCCCAGGGAGG - Intronic
1106865877 13:33963340-33963362 GCAGACATGAAGGCTCAGGATGG + Intronic
1107115081 13:36738263-36738285 GCAGAAATGAAGGCCCAGGCAGG + Intergenic
1107570514 13:41652624-41652646 AAAGAAATTAAGGCCCAGAGAGG + Intronic
1107571337 13:41661504-41661526 GGAGAAACTAAGGCCCAGAGAGG - Intronic
1107867802 13:44719871-44719893 GCAGACATTAAGGTCCAGGGAGG + Intergenic
1108498786 13:51049915-51049937 AAAGAAATCAAGGCCCAGAGGGG - Intergenic
1110203198 13:72878037-72878059 GCAGAAATGAAGGCCGGGCATGG - Intronic
1113286292 13:108852456-108852478 GAAGAACTTAAGGCCCAGAGAGG - Intronic
1113361748 13:109638215-109638237 GGAGAAATGAAGGCCAAGTTAGG + Intergenic
1113512401 13:110866660-110866682 GTGGAAATGAAGGCACAGAGAGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114657287 14:24323700-24323722 GAAGAAACTAAGGCCCAGAGAGG - Intronic
1114851974 14:26392681-26392703 GAGGAAATGAAGGCCAAGTATGG + Intergenic
1115061967 14:29203171-29203193 GCAGAATTGGAGGCTCAGAGAGG + Intergenic
1117339750 14:54783084-54783106 GCAGAAAAAAAGTCCCAGAGGGG - Intronic
1118211227 14:63767566-63767588 GTAGGAATCAGGGCCCAGTGTGG - Intergenic
1118335610 14:64851304-64851326 GAAGAAATAAAGGCACAGAGAGG - Intronic
1118445006 14:65842828-65842850 GAAGAAATGGAGGCTCAGTGTGG + Intergenic
1118775942 14:68974053-68974075 GCATAAAAGCAGGGCCAGTGGGG + Intronic
1119109513 14:71958504-71958526 GAAGAAACTAAGGCCCAGTGGGG + Intronic
1119864622 14:77962951-77962973 GAAGAAATGCAGGCTCAGAGAGG + Intergenic
1121102365 14:91258719-91258741 GCAGAAACCAAGGCCCAGGGAGG - Intergenic
1121309472 14:92927790-92927812 AAAGAAATCAAGGCCCAGAGAGG + Intronic
1121576608 14:94994011-94994033 GCATAAGTGAAAGTCCAGTGTGG - Intergenic
1122255696 14:100474012-100474034 CCAGAAGTGAAGGCTCAGAGGGG + Intronic
1122743454 14:103884984-103885006 GGGGAAATGGAGGCCCAGAGAGG - Intergenic
1122856404 14:104562310-104562332 GCAGGAATCAAGGCCCAGGGTGG + Intronic
1124168400 15:27350237-27350259 GGGGAAATGAAGGCTCAGAGAGG + Intronic
1124510697 15:30322005-30322027 GCATAATTGAAGGCCAGGTGTGG - Intergenic
1125482006 15:40087599-40087621 GAAGAACTGAAGGCTCAGAGAGG + Intergenic
1125747262 15:42005404-42005426 GGGGAAAGTAAGGCCCAGTGAGG - Intronic
1126161352 15:45616565-45616587 CCAGAAATGCAGGCCCAGGAAGG - Intronic
1126164375 15:45641958-45641980 TCAGAAATTCAGGCACAGTGAGG - Intronic
1127629323 15:60812137-60812159 GGAGAAATTAAGGCACAGAGTGG - Intronic
1127824025 15:62687331-62687353 GAAGAAATTAAGGCTCAGAGAGG - Intronic
1128332738 15:66766440-66766462 GAGGAAATGAAGGCTCAGGGAGG - Intronic
1128369429 15:67029538-67029560 GCAGAAACTGAGGCCCAGAGAGG + Intergenic
1128482635 15:68053740-68053762 TCAGAAATGAAAGCTCAGAGAGG - Intergenic
1128564572 15:68692179-68692201 GAGGAAATTAAGGCCCAGAGAGG - Intronic
1128634905 15:69296990-69297012 GATGAAATGGAGGCCCAGAGAGG - Intergenic
1128658373 15:69479159-69479181 GAAGAAATCGAGGCCCAGAGAGG - Intergenic
1128758728 15:70200353-70200375 GAAGACATGAAGGCTCAGAGAGG - Intergenic
1129199360 15:73989705-73989727 TGAGAAATGAAGGCCCAGAGAGG + Intronic
1129254993 15:74329406-74329428 GCGGAAACCAAGGCCCAGAGAGG - Intronic
1131080470 15:89530351-89530373 GAAGGAAGGAAGGCCCAGTAGGG + Intergenic
1132658136 16:1049765-1049787 GCAGAGATGAAGGGGCAGTGAGG - Intergenic
1133217165 16:4299623-4299645 GCAGAAAAGAATTCCAAGTGTGG + Intergenic
1134333191 16:13269316-13269338 GCAGAAAGTAAGGCTCAGAGAGG - Intergenic
1134603648 16:15552824-15552846 GAAGAAATCAATGCCCAGAGAGG - Intronic
1134662314 16:15993408-15993430 GAAGAAATCAAGGCCTGGTGAGG + Intronic
1134913296 16:18048619-18048641 GAAGAAATGAAGGACCAGAGAGG + Intergenic
1135170864 16:20182128-20182150 GCAGAAATGGAAGCTCAGAGAGG + Intergenic
1135745145 16:25010750-25010772 GTGGTAATGTAGGCCCAGTGTGG - Intronic
1135783173 16:25324184-25324206 GAGGAAATAAAGGCCCAGTGAGG - Intergenic
1135857024 16:26021301-26021323 GCAGGAATGCAGGTCCAGTGTGG - Intronic
1135886702 16:26316642-26316664 ACAGCAATGTGGGCCCAGTGTGG + Intergenic
1136048439 16:27633754-27633776 GAAGAAATCAAGGCCAAGAGAGG + Intronic
1136145691 16:28315189-28315211 TGAGAAATGAATGCCCAGAGTGG + Intronic
1136545448 16:30951786-30951808 GCAGGAACGCAGGCCAAGTGTGG + Intronic
1136613506 16:31381342-31381364 TGAGAAATCAAGGCCCAGAGTGG - Intronic
1136939740 16:34511703-34511725 ACAAGAATGAGGGCCCAGTGCGG + Intergenic
1136960080 16:34836861-34836883 ACAAGAATGAGGGCCCAGTGCGG - Intergenic
1137290376 16:47048572-47048594 GAGGAAATGAAGGCTCAGAGAGG + Intergenic
1137391205 16:48082716-48082738 TCAGGAATGAAGGCCCCATGAGG - Intergenic
1138134689 16:54511602-54511624 GAAGAAACCAAGGCACAGTGTGG - Intergenic
1138147704 16:54627209-54627231 GAAGAAATGAAGACTCAGAGCGG + Intergenic
1138386820 16:56641137-56641159 GAAGAAATGGAGGCTCAGAGAGG - Intronic
1138516459 16:57537923-57537945 GAGGAAATGAAGGCTCAGAGAGG + Intergenic
1138831177 16:60376533-60376555 GCAGAAACTAAGCCTCAGTGAGG - Intergenic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140251427 16:73297762-73297784 GAAGAAATGGAGGCTCAGAGAGG - Intergenic
1140745472 16:77976784-77976806 GCGGAAATGAAGACCCAGAGGGG + Intronic
1140948315 16:79791973-79791995 GCAGAAATGGAGGCCTGGAGTGG - Intergenic
1141093238 16:81144828-81144850 GAAGAAATGAAGTCTCAGAGAGG + Intergenic
1141267782 16:82512569-82512591 GGGGAAATGGAGGCCCAGAGGGG - Intergenic
1141753992 16:85979153-85979175 GCAGAAATGAAAGCCCAGAGAGG - Intergenic
1142390366 16:89795891-89795913 GCTGAAAGGTAGGCCCAGTGTGG - Exonic
1143975921 17:10829501-10829523 GCAGAGACTGAGGCCCAGTGGGG + Intronic
1144468096 17:15512955-15512977 GAAGAAATTAAAGCCCAGGGAGG - Intronic
1144701260 17:17342297-17342319 GAAGAAATGGAGGCTCAGAGAGG - Intronic
1144764715 17:17726104-17726126 GCGGAAATGAGAGCCCAGAGAGG + Intronic
1144822923 17:18088099-18088121 GCAGAAAGGAAGGCCCCGCCCGG - Intronic
1144835635 17:18155286-18155308 GCAGAGATGAAGGGCGTGTGAGG - Intronic
1144853582 17:18256425-18256447 GCAGAAATGCTGGCCCAGCTTGG + Intronic
1145296608 17:21598126-21598148 GCAGACATGAAGGCCCTGACAGG + Intergenic
1145367167 17:22273949-22273971 GCAGACATGAAGGCCCTGACAGG - Intergenic
1145936275 17:28716806-28716828 GCTGAAATGAAGCCCCAAGGGGG + Intronic
1146012576 17:29207592-29207614 CCAGAAAAGAAGGCCAGGTGTGG - Intergenic
1146664767 17:34692029-34692051 GCAGGAATGATGGCTCAGTTAGG + Intergenic
1147038243 17:37697941-37697963 GAAGAAATGAAGGCTCAGGGAGG + Intronic
1147604015 17:41763762-41763784 GCAGCAGTGAAGGCCCAGAAAGG - Intronic
1147778194 17:42918904-42918926 ATAGAAATGAAGGCCAAGAGAGG + Intergenic
1147886685 17:43688947-43688969 GGAGAAACAAAGGCCCAGAGAGG - Intergenic
1148006233 17:44432478-44432500 GCAGCTCTGAGGGCCCAGTGAGG + Intronic
1148382288 17:47208910-47208932 GCAGAGCTGAGGGCCCAGAGTGG + Intronic
1148723004 17:49768310-49768332 GCATAAATGGAGGCACAGGGTGG - Intronic
1149640361 17:58198906-58198928 GAAGAGATGGAGGTCCAGTGAGG + Intronic
1150267574 17:63841296-63841318 TTAGAAGTGAGGGCCCAGTGGGG + Intronic
1150290725 17:63980074-63980096 GGAGAAACTAAGGCCCAGAGGGG + Intergenic
1151117559 17:71754983-71755005 GTGGAAATCAAGGCTCAGTGTGG - Intergenic
1151222358 17:72622531-72622553 AGAGAAATGGAGGCCCAGGGAGG - Intergenic
1151485496 17:74396728-74396750 GAAGAAATGGAGGCTCAGAGAGG + Intergenic
1151967645 17:77439777-77439799 GCAGAGGCGAAGGCCCAGGGCGG - Intronic
1152659570 17:81535980-81536002 TCAGAAAGGAAAGCCCACTGGGG + Intronic
1152719404 17:81915520-81915542 GCAGAAAGGAAGGCAAGGTGAGG + Intronic
1152730223 17:81966507-81966529 GGGGAAACGAAGGCCCAGAGGGG + Intergenic
1154097258 18:11430085-11430107 GCAGAAATACAAGCCAAGTGTGG + Intergenic
1154263051 18:12854768-12854790 GAAGAAATAAAGGCAAAGTGAGG + Intronic
1154365957 18:13709347-13709369 GCAGAGCTGCAAGCCCAGTGTGG - Intronic
1155595737 18:27483782-27483804 AAAGAGATGAAGGCTCAGTGAGG + Intergenic
1156038539 18:32793930-32793952 GCAGACATGGGGGCCCACTGAGG - Intergenic
1156495111 18:37520392-37520414 GTAGAAATGAAGGCCCAGAGAGG + Intronic
1157513183 18:48293247-48293269 GCAGTGAGGAAGGCCAAGTGAGG - Intronic
1158045414 18:53149390-53149412 GTGGAAATTAAGGCCCAGAGAGG + Intronic
1158369764 18:56787173-56787195 ACTGAAATGAAGGGCAAGTGTGG - Intronic
1158521518 18:58175212-58175234 GCACAGATGCAGGCCCAGTGTGG - Intronic
1159764706 18:72474273-72474295 GCAGAAAGGAAGCCGGAGTGTGG - Intergenic
1160709804 19:545931-545953 ACAGAAATTAAGGCCGGGTGCGG - Intronic
1160753806 19:747594-747616 GGAGGAAGGAGGGCCCAGTGGGG - Exonic
1160919201 19:1511999-1512021 GGAGAAACTAAGGCCCAGAGAGG - Intronic
1161162901 19:2770485-2770507 GGGGAAATGGAGGCACAGTGAGG - Intronic
1161213366 19:3079928-3079950 TCAGTTATGAAGGCCGAGTGTGG + Intergenic
1161417802 19:4157357-4157379 GAGGAAATGGAGGCCCAGAGAGG + Intronic
1161560983 19:4972289-4972311 GAAGAAAGCAAGGCCCAGAGAGG - Intronic
1162032371 19:7923039-7923061 GCAGACAACAAGGCACAGTGGGG - Exonic
1162107934 19:8381986-8382008 TCTGAATTGAAGTCCCAGTGGGG - Intronic
1162145005 19:8608215-8608237 GAAGAAACCAAGGCCCAGAGAGG - Exonic
1162705588 19:12552513-12552535 GCTGAAATGGAACCCCAGTGTGG + Intronic
1162832377 19:13293816-13293838 GAGGAAATGGAGGCCCAGAGAGG + Intronic
1163170763 19:15529553-15529575 GAGGAAATGGAGGCCCAGGGAGG + Intronic
1163377177 19:16940431-16940453 GAAGAAATGGGGGCCCAGAGAGG - Intronic
1163420469 19:17211269-17211291 TCAGAAATAAAGGCCGAGTGCGG - Intronic
1165059928 19:33200151-33200173 ACAGAAGGGAAGGCCCAGTGAGG - Intronic
1165245657 19:34497151-34497173 TCAGAAAAGAAGGCCTGGTGTGG - Intronic
1165416698 19:35698595-35698617 GAAGAGATTAAGGCCCAGAGGGG + Intergenic
1165465353 19:35971439-35971461 GAAGAAATTGAGGCCCAGAGAGG - Intergenic
1167281507 19:48571972-48571994 CAAGAAATGGAGGCCCAGAGAGG - Intronic
1167300546 19:48675051-48675073 GAGGAAATGAAGGCACAGAGAGG - Intergenic
1167329335 19:48845157-48845179 GAAAAAATGAAGGCACAGAGAGG + Intronic
1167608555 19:50494844-50494866 ACAGAAATGAAGGCACAGACAGG + Intergenic
1167751575 19:51383725-51383747 GAAGAAATGGAGGCCCAGAGAGG + Intronic
1167755893 19:51413517-51413539 GAAGAAATGAAGGCTCAGAGGGG + Intronic
1167766988 19:51490133-51490155 GAAGAAATGAGGGTCCAGAGAGG - Intronic
1168094626 19:54107650-54107672 GTGGAAGGGAAGGCCCAGTGTGG - Intronic
1168273845 19:55265502-55265524 GGGGAAATGGAGGCCCATTGTGG - Intronic
925179657 2:1808779-1808801 GCAGAAATGTGGGCACACTGGGG + Intronic
925786172 2:7433025-7433047 GTGAAAATGAAGGCCCAGTGTGG - Intergenic
925797909 2:7566779-7566801 GCAGAAAGGAGTGCCCAGTGTGG - Intergenic
926229062 2:10989229-10989251 GCAGGAAGGAAGGCTCTGTGAGG - Intergenic
926296059 2:11569680-11569702 ACAGAGATGAAGGCACAGAGAGG + Intronic
926602884 2:14865147-14865169 GGAGAAATGGAAGCTCAGTGAGG - Intergenic
926653273 2:15370238-15370260 GATGAAATCAAGGCCCAGGGAGG - Intronic
926972791 2:18483779-18483801 TCAGAAACCAAGGCCCAGAGAGG - Intergenic
927477598 2:23425880-23425902 GCACAAATCAAAGCCCAGAGAGG + Intronic
927881318 2:26692101-26692123 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
927886776 2:26723670-26723692 GAGGAAATGGAGGCCCAGAGAGG - Intronic
928357887 2:30637202-30637224 GCAGAAATGAATGGCCTCTGAGG + Intronic
928451629 2:31383281-31383303 GAGGAAATGAGGGCCCAGAGTGG + Intronic
929085284 2:38161908-38161930 GCAGAAAGGAAGCCACACTGTGG - Intergenic
929158531 2:38809751-38809773 ACAGCAAAGAAGGCCGAGTGCGG - Intronic
929353074 2:40984095-40984117 GAAGAAATCAAGGCCGGGTGTGG - Intergenic
929978157 2:46654662-46654684 GCAGACCTGAGCGCCCAGTGTGG - Intergenic
930811272 2:55544339-55544361 GCAGAAAGGAAAACCCACTGGGG + Exonic
931177902 2:59871642-59871664 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
931946179 2:67310444-67310466 GAAGAAAGGAAGGCCCACAGAGG - Intergenic
932659759 2:73641908-73641930 GAAGAAATGGAGGCTCAGAGAGG - Intronic
933687798 2:85157428-85157450 GAGGAAATCAAGGCCCAGAGAGG + Intronic
933805408 2:85995464-85995486 GAAGAAACTAAGGCCCAGAGAGG + Intergenic
934706231 2:96483559-96483581 GAGGAAATCAAGGCACAGTGAGG + Intergenic
934992744 2:98933032-98933054 GTAGAAATGGAGGCCTAGTACGG + Intronic
935639256 2:105275118-105275140 GCAGGGATGAGGGCCCAGTGTGG + Intronic
936069036 2:109353272-109353294 GCAGCCATGCAGGCCCAGGGAGG - Intronic
936513623 2:113168039-113168061 GCAGAAATGAAAACCCAGGTGGG - Intronic
936945056 2:117922711-117922733 GCAGAAGTAGAGGGCCAGTGAGG + Intronic
937365756 2:121260158-121260180 GAAGAAACTAAGGCCCAGAGAGG + Intronic
937948439 2:127364152-127364174 GCAGAAATCAAGGACCAGGAAGG - Intronic
938737991 2:134203865-134203887 GAAGAAATGAATGTCCAGAGAGG - Intronic
940959563 2:159769350-159769372 GAAAAAATGTAGGCCAAGTGTGG + Exonic
941038878 2:160598383-160598405 GGAGAAATAGAGGCCAAGTGGGG - Intergenic
941780054 2:169433875-169433897 GTAGAAGTGTAGGCCCAGTGTGG - Intergenic
941802090 2:169671235-169671257 GCACAAGTGAAGGCCCAGAGTGG - Intronic
942905123 2:181171409-181171431 GCACAAATGAAGGTCTAGAGAGG + Intergenic
943016920 2:182524143-182524165 TTACAAATGAAGGCACAGTGAGG - Intergenic
944208313 2:197180381-197180403 GCAGGAATGCAGGTGCAGTGTGG - Intronic
946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG + Intronic
946438357 2:219674581-219674603 GAAGAAATGGAGCCTCAGTGAGG + Intergenic
946891189 2:224278701-224278723 GCAGAAATGATGACACAGTGTGG + Intergenic
947624652 2:231612138-231612160 GGAGAAATTGAGGCCCTGTGCGG + Intergenic
947907674 2:233777376-233777398 ACGGAAAAGAAGGCTCAGTGGGG + Intronic
948139876 2:235664676-235664698 GTGGAAATGAAGTCTCAGTGTGG + Intronic
948565596 2:238884309-238884331 GGAGAAGTGAGGTCCCAGTGAGG + Intronic
948827134 2:240578243-240578265 GCAGACATTAAGGCACAGTGTGG - Exonic
1168842345 20:917435-917457 GAGGAAATGAAGGCACAGAGAGG - Intergenic
1168909451 20:1435493-1435515 GAAGAAAAGGAGGCCCAGAGGGG + Intergenic
1168956450 20:1837695-1837717 GGAGAAATTGAGGCCCAGAGAGG - Intergenic
1168965517 20:1895661-1895683 GCAGAAACTGAGGCCCAGAGAGG + Intronic
1169248445 20:4042216-4042238 GCAGAAATAAAGGACTAGGGAGG - Intergenic
1169318472 20:4612000-4612022 GCGGAAGGGAAGGACCAGTGAGG + Intergenic
1169466100 20:5840655-5840677 GCAGAAATGAACGGCCAAAGGGG - Intronic
1169535303 20:6532578-6532600 CCACAAATGTGGGCCCAGTGTGG - Intergenic
1169715029 20:8606372-8606394 GAGGAAATGAAGGCACAGAGAGG - Intronic
1170136198 20:13075983-13076005 GCAGAAATGAAGGTCCCATTTGG + Intronic
1171440562 20:25158132-25158154 TCCCAGATGAAGGCCCAGTGAGG - Intergenic
1171849936 20:30300969-30300991 GAACAAATGGAGGCCCAGAGAGG + Intergenic
1171987010 20:31667564-31667586 TTGGAAATGTAGGCCCAGTGTGG - Intronic
1172205889 20:33162651-33162673 GAGGAAATGCAGGCCCAGAGAGG + Intronic
1172321034 20:33994927-33994949 GCAGAAATTAAGGCGCAGAGGGG + Intronic
1172701096 20:36854210-36854232 GGAGAAACTAAGGCCCAGAGAGG - Intronic
1172791554 20:37509358-37509380 GGGGAAACCAAGGCCCAGTGAGG + Intronic
1172901332 20:38337014-38337036 GGAGAAAGGCAGGGCCAGTGGGG - Intronic
1172919118 20:38466622-38466644 GTACAAGTGAGGGCCCAGTGAGG + Intergenic
1173467735 20:43296559-43296581 TCAGATGTGAAAGCCCAGTGGGG - Intergenic
1174079150 20:47958603-47958625 GCAGAAATAATGGGCCACTGTGG - Intergenic
1174138510 20:48397168-48397190 GCAGAAATAATGGGCCACTGTGG + Intergenic
1174208431 20:48857973-48857995 GCAAAAAGGAAAGTCCAGTGGGG + Intergenic
1174404053 20:50292481-50292503 GGAGAAACCAAGGCCCAGAGAGG - Intergenic
1174419217 20:50388751-50388773 GCAAAAATAAGGGCCCAGTGTGG - Intergenic
1174463559 20:50699866-50699888 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1174555739 20:51394234-51394256 TCAGAACTTAAAGCCCAGTGTGG - Intronic
1175213122 20:57374168-57374190 ACAGAAAACAAGGCCAAGTGCGG - Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1176078062 20:63257961-63257983 GCACAAACGCAGGCCGAGTGGGG + Intronic
1176161542 20:63651273-63651295 GGAGGAATGAAGGCTCAGAGAGG + Intronic
1176272974 20:64246149-64246171 GAAGAAACCAAGGCCCAGGGAGG + Intergenic
1176715605 21:10346825-10346847 GCAGCTCAGAAGGCCCAGTGTGG + Intergenic
1177172694 21:17671407-17671429 TCAGAAATGAAGACCCAGGCTGG - Intergenic
1178424972 21:32471916-32471938 TAAGAAATGGAGGCCGAGTGCGG - Intronic
1179878078 21:44281613-44281635 GAGGAAATTGAGGCCCAGTGAGG + Intergenic
1180178640 21:46106401-46106423 GAGGAAACCAAGGCCCAGTGAGG - Intronic
1181276615 22:21691232-21691254 TAAGAAAAGAAGGCCGAGTGTGG - Intronic
1181750270 22:24984293-24984315 GAGGAAATGCAGGCCCAGAGAGG + Intronic
1181812135 22:25409720-25409742 GCAGAAACTGAGGCCCAGAGAGG - Intergenic
1181821175 22:25476937-25476959 GCAGAATTCAGAGCCCAGTGTGG + Intergenic
1182015189 22:27033233-27033255 GGAGGAATAAAGGCCCAGAGAGG + Intergenic
1182060856 22:27396191-27396213 GCAGAAACCAAGGCCCAGTGAGG - Intergenic
1182108125 22:27703902-27703924 GCAGAAGAGAAGGCCGTGTGGGG - Intergenic
1182138468 22:27930472-27930494 GAAGAAATGAAGGTCCAGAAGGG + Intergenic
1182433374 22:30314326-30314348 GCAGAAACCAAGTCCCAGAGAGG - Intronic
1183111954 22:35656742-35656764 GCAGAGATGAGGCCCCAGAGTGG - Intronic
1183700223 22:39446856-39446878 GAGGAAATGAAGGCACAGAGAGG + Intergenic
1184192313 22:42903084-42903106 GCTGCAGTGAAGGCCCGGTGAGG - Intronic
1184261631 22:43320771-43320793 GAAGAAACCAAGGCACAGTGAGG + Intronic
1184263873 22:43336188-43336210 GGAGAAACTAAGGCTCAGTGAGG + Intronic
1184665734 22:45987966-45987988 GCAGAGAGGAAGCCCCAGAGAGG - Intergenic
1184830880 22:46985799-46985821 GAATAAATGAAGACCCTGTGGGG - Intronic
1185065053 22:48627975-48627997 GGGGAAATGGAGGCTCAGTGTGG + Intronic
949548052 3:5089525-5089547 GCAGGAATGACAGCCGAGTGGGG + Intergenic
949735074 3:7162431-7162453 GATGAAATGAAGGTCCAGTGAGG + Intronic
950109372 3:10408672-10408694 TCAGAAACCAAGGCCCAGAGAGG - Intronic
950467830 3:13165809-13165831 TCAGAAATGCAGGAACAGTGTGG - Intergenic
950715776 3:14846762-14846784 GAAGAAAGCAAGGCCCAGGGGGG - Intronic
950749265 3:15115961-15115983 GCAGAGATGAGAGGCCAGTGGGG - Intergenic
950838023 3:15939375-15939397 GAAGAAACTAAGGCCCAGGGAGG + Intergenic
951463631 3:22977950-22977972 GCAGGAGCTAAGGCCCAGTGGGG - Intergenic
951691167 3:25397781-25397803 GAAGAGATTAAGGCCCACTGAGG - Intronic
951696196 3:25448069-25448091 GCAGAAATTGAGGCTCAGAGAGG + Intronic
952402996 3:32980340-32980362 GAAGTAAGGAGGGCCCAGTGTGG - Intergenic
952764351 3:36942328-36942350 GAAGAAATTAAGGCCCAGAAAGG - Intronic
953485445 3:43290082-43290104 TAAGAAATTGAGGCCCAGTGAGG - Intronic
953714481 3:45306139-45306161 GCAGAGATGAAGGCTGAGTGGGG - Intergenic
953746674 3:45579618-45579640 GCAGAAATGGAAGCTCAGTGAGG - Intronic
953750698 3:45606418-45606440 GCAGCAAAGAAGGCAGAGTGTGG + Intronic
954082760 3:48222132-48222154 GCAGTCAAGGAGGCCCAGTGGGG + Intergenic
954621436 3:51998261-51998283 GCAGGAATAAAGTCCCTGTGGGG + Intergenic
955093688 3:55776214-55776236 GGACAAATGGAGGCCCCGTGTGG - Intronic
955149762 3:56355519-56355541 GCAGAAATTCAAGACCAGTGTGG - Intronic
955779020 3:62463688-62463710 AAAGCAATGAAGGCCCAGAGAGG - Intronic
956036681 3:65100764-65100786 GCAGAACTACAGGACCAGTGTGG - Intergenic
956384924 3:68706324-68706346 TCAGAAATGATGGCCCAGAGTGG - Intergenic
956679060 3:71761038-71761060 ACAAAAAAAAAGGCCCAGTGCGG - Intergenic
956847046 3:73193236-73193258 GCAGAAAGGTAGGGCTAGTGGGG - Intergenic
959497973 3:107073288-107073310 GAAGAAATTAAGGCACAGAGGGG - Intergenic
961008011 3:123417747-123417769 GAAAAAATGGAGGCCCAGAGAGG - Intronic
961098087 3:124174920-124174942 GCAGAATTTAAGTCCTAGTGGGG + Intronic
961364977 3:126394011-126394033 CCAGCAATGTAGTCCCAGTGAGG - Intergenic
961644839 3:128387385-128387407 TCAGAAATGAAGGTGCTGTGTGG + Intronic
961655213 3:128438196-128438218 CCATAAAGGAAGGCCCCGTGGGG - Intergenic
962217311 3:133533817-133533839 GCAGAAATGATGGCTGTGTGTGG - Intergenic
963595605 3:147320521-147320543 ATAGAAATGCAGGCCCATTGTGG - Intergenic
965510625 3:169565093-169565115 GAAGAAAGGAAAGCTCAGTGTGG + Intronic
965673489 3:171171471-171171493 GCAGGTGTGCAGGCCCAGTGAGG - Intronic
965782713 3:172304594-172304616 GCAGGAAAGAGGGCCGAGTGAGG + Intronic
966678778 3:182618403-182618425 GCAAAAATGAAGGCAAAATGTGG - Intergenic
967292730 3:187936897-187936919 GAAGAAATAAAGGCCCAAAGAGG + Intergenic
967340361 3:188390521-188390543 GAGGAAATTAAGGCTCAGTGAGG + Intronic
967847786 3:194057793-194057815 GCACCAAAGAAGGCCCAGAGAGG - Intergenic
967933131 3:194705226-194705248 GAGGAAATGAAGGCACAGAGAGG + Intergenic
968382520 4:108284-108306 GCAGAAACGGAGGCCCACGGAGG + Intergenic
968557017 4:1250603-1250625 GCAGACAGGAAAGTCCAGTGAGG - Intergenic
968654724 4:1773532-1773554 GCAGAAGTGCATGGCCAGTGCGG - Intergenic
968805361 4:2768421-2768443 GCTGAGATGAAGGCTCCGTGGGG - Intergenic
968812635 4:2806814-2806836 TGAGAGAGGAAGGCCCAGTGGGG + Intronic
969364296 4:6685058-6685080 GCAGGAACGGATGCCCAGTGTGG + Intergenic
969712426 4:8851709-8851731 GGAGAAATGGAGGCCCCGAGAGG - Intronic
969887137 4:10225082-10225104 GCAGAACTGACGGCCTAGTAAGG - Intergenic
970455439 4:16219123-16219145 GAAGAAACCAAGGCCCAGAGAGG + Intronic
970525811 4:16930990-16931012 GTAGAAATGAAGGCTCAGTAAGG + Intergenic
971019413 4:22518355-22518377 ACGTAGATGAAGGCCCAGTGTGG - Intergenic
971556405 4:28017678-28017700 TCAGAAATGAGGAACCAGTGTGG + Intergenic
973637994 4:52877512-52877534 GAAGAAATTGAGGCTCAGTGTGG - Intronic
973741713 4:53925211-53925233 GAAGAAATGGAGGCACAGAGAGG - Intronic
974532263 4:63124213-63124235 CCAGGAATGAAGACCCAGTGAGG - Intergenic
976123388 4:81806987-81807009 GAAGAGATGAAGGCTCAGAGAGG + Intronic
976294271 4:83454330-83454352 GAAGAAATGGAGGCCCAAAGAGG + Intronic
976545823 4:86334593-86334615 GCATATGTGAAGGTCCAGTGGGG - Intronic
977295504 4:95204497-95204519 GCAGGAATGCAGGCCAAGTATGG + Intronic
977571381 4:98632941-98632963 ACAGACATGAAGGACCACTGAGG + Intronic
978853523 4:113366815-113366837 GCAGAAATGCAAGTTCAGTGGGG + Intronic
979579118 4:122334971-122334993 TCAGAAATGTAGGCACAGTTTGG + Intronic
979971559 4:127142026-127142048 GCAGACATGAAAGGTCAGTGTGG - Intergenic
980900857 4:138903963-138903985 GTAGAAATGGAGGCTCAGAGAGG - Intergenic
980908511 4:138972667-138972689 CCAGAAATGGAGGCCAAGTGTGG - Intergenic
981101956 4:140838906-140838928 GCAGAAACAAAGGCACAGGGAGG + Intergenic
982256202 4:153453742-153453764 TGAGAAATGAAGGCACAGAGAGG + Intergenic
983514339 4:168640756-168640778 GAAGAAATTAAGGCTCAGTGAGG + Intronic
983562309 4:169113549-169113571 GCAGAAATGATGGAGCAATGGGG + Intronic
983845012 4:172507133-172507155 GAAGAAATGCATGCCCAGAGAGG - Intronic
985705543 5:1399616-1399638 GCAGGACCGGAGGCCCAGTGGGG + Intronic
988444418 5:31269471-31269493 GAAGAAATGAAAGCCCAGAAAGG - Intronic
989559912 5:42838281-42838303 GAAGTATTGAAGGCCCAGTCAGG + Intronic
990264924 5:54064638-54064660 GAAGAAATTAAGGCACAGAGTGG - Intronic
990307896 5:54510920-54510942 GCAGAAATGCTGGCCCTGTGTGG + Intergenic
991304461 5:65161524-65161546 GCTCAAATGAAGGACCAATGAGG - Intronic
991925452 5:71701020-71701042 GAAGAAACTAAGGCCCAGAGAGG - Intergenic
993109227 5:83635024-83635046 GAAGAAATTAAGGCCCAATCAGG - Intergenic
994377518 5:99031967-99031989 GCAGTAATGAAGGCACTGTTTGG + Intergenic
995642087 5:114268445-114268467 GCAGAAATAAAAGTCTAGTGAGG - Intergenic
995892559 5:116971666-116971688 CCAGAAAAGACTGCCCAGTGTGG + Intergenic
997439896 5:133901703-133901725 GCGGAAATTGAGGCCCAGAGAGG - Intergenic
997541696 5:134668433-134668455 ACAGAAATTAAGGCCAGGTGCGG + Intronic
997851912 5:137340467-137340489 GCAGAACTGAAGGCTCAGATAGG - Intronic
998477987 5:142437395-142437417 GAAGAAATTAAGACCCAGAGAGG - Intergenic
998960678 5:147483156-147483178 GGAGAAATTAAGGCCCAGAAAGG + Intronic
999097395 5:148992192-148992214 GCAGAAATGGAGGCCCAGAATGG + Intronic
999257231 5:150216481-150216503 GAGGAAACGAAGGCCCAGAGAGG + Intronic
999410333 5:151344766-151344788 GAGGAAATGAAGGCTCAGAGAGG + Intronic
999517766 5:152318203-152318225 GCAGAAACCAAGGCTCAGTGAGG - Intergenic
999673449 5:153976977-153976999 GCAGAAATAAATGGCCACTGGGG - Intergenic
999719408 5:154387615-154387637 GTAGAAACCAAGGCTCAGTGAGG - Intronic
1001406603 5:171481456-171481478 GATGAAATTAAGGCCCAGAGAGG + Intergenic
1001407572 5:171486749-171486771 GCAGAAATGAAGGACAAGGAGGG + Intergenic
1001756302 5:174172921-174172943 GCAGATGTGAAGGCTCAGAGGGG + Intronic
1001776797 5:174334903-174334925 GAAGAAAATAAGGCCCAGAGAGG - Intergenic
1001942046 5:175747679-175747701 GAAGAAATGGAAGCCCAGAGAGG + Intergenic
1001964086 5:175898084-175898106 GCAGAGATGCGGGCCCTGTGTGG + Intergenic
1002053741 5:176586557-176586579 GCGGAAATGGAGGCCCAGAGAGG - Intronic
1002536820 5:179880355-179880377 GCAGAAAGCAAAGTCCAGTGGGG + Intronic
1002789104 6:424778-424800 GCAGAAAGGAAGGCCCGGCGGGG - Intergenic
1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG + Intronic
1003476321 6:6487248-6487270 GGAGAGATGAAGGCCCGGCGAGG - Intergenic
1003543038 6:7034912-7034934 GCAAAAATGAAGGCTGGGTGCGG + Intergenic
1004316656 6:14593927-14593949 ACAGAACTGAAGGCCAAGAGTGG - Intergenic
1004639924 6:17505370-17505392 GCAGAAATGACTGCCCTCTGGGG + Intronic
1005332668 6:24764862-24764884 GGCGAAAGGGAGGCCCAGTGGGG - Intergenic
1005818164 6:29574380-29574402 GCAGAAAGGCAGGCGCAGGGTGG - Intronic
1006458810 6:34146232-34146254 GGAGAAACTGAGGCCCAGTGAGG + Intronic
1006743829 6:36327422-36327444 GGAGAGATAAAGGCCCAGAGAGG - Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1008483333 6:52008964-52008986 GCAGAAACTGAGGCCCAGAGAGG + Intronic
1009994154 6:70880368-70880390 GAAGAAATGGAGGCACAGAGAGG + Intronic
1010705970 6:79111162-79111184 GCTAAAATGAAAGTCCAGTGGGG + Intergenic
1010869582 6:81021161-81021183 GCACAAATTGAGGCCCTGTGGGG + Intergenic
1011167034 6:84460155-84460177 AAAGAAATTAAGGCTCAGTGAGG - Intergenic
1011798534 6:90983434-90983456 GGAAACATGCAGGCCCAGTGAGG - Intergenic
1013082308 6:106823388-106823410 GGAGAAATGAGGCCCTAGTGAGG - Intergenic
1015985973 6:138884345-138884367 ACAGATATTAAGGCTCAGTGCGG + Intronic
1016704208 6:147088144-147088166 GCAGAAAGGAAGGCTTTGTGGGG + Intergenic
1017472500 6:154753173-154753195 ACAAAAATTAAGGCCCGGTGTGG + Intronic
1021614565 7:22488560-22488582 TCTGAAATGCAGACCCAGTGGGG + Intronic
1021808580 7:24380428-24380450 TCATAAATGAAGCCCAAGTGAGG - Intergenic
1022190880 7:28015969-28015991 GCTGAGATGAGGGCCCTGTGGGG - Intronic
1022302057 7:29111031-29111053 GCTGAAATCAAGGACCAGTAGGG - Intronic
1022377679 7:29829671-29829693 GAAGAAAAGGAGGCCCAGTAAGG + Intronic
1022521091 7:31007334-31007356 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1023030273 7:36084874-36084896 GCAGACAGGAAGGCCAAGGGAGG + Exonic
1023655636 7:42417628-42417650 GCAAAAAAGAAGGCTTAGTGAGG + Intergenic
1024651615 7:51408310-51408332 AAAGAAATGGAGGCCCAGAGTGG + Intergenic
1025249381 7:57341895-57341917 GGAGAAAAAAAGGCCCAGAGAGG - Intergenic
1025251741 7:57355945-57355967 ACAAAAATGAGAGCCCAGTGTGG + Intergenic
1025551230 7:62252417-62252439 ACAAGAATGAAGACCCAGTGTGG + Intergenic
1027419064 7:78002461-78002483 GAAAAAATGAAGGCTGAGTGTGG + Intergenic
1027812306 7:82919426-82919448 GAAGAAATAGAGACCCAGTGTGG + Intronic
1028898760 7:96072156-96072178 GCAGACATGAAGGGCAAGGGAGG - Intronic
1029388503 7:100259165-100259187 TGTGAAATCAAGGCCCAGTGCGG - Intronic
1029957185 7:104652295-104652317 CCAGCATTGAAGGGCCAGTGGGG + Intronic
1030022587 7:105290746-105290768 GAAGAAATGAAGGCCGGGCGCGG + Intronic
1030152049 7:106417321-106417343 GCACAAAGCAAGACCCAGTGAGG - Intergenic
1030461774 7:109846454-109846476 GAAGAAATTAAGACCCAGTGAGG + Intergenic
1030717957 7:112832797-112832819 ACAGAAATGAAAGCTCATTGGGG - Intronic
1031833493 7:126654327-126654349 AAAGAAATGAAAGCCCAGAGAGG - Intronic
1032095670 7:128937600-128937622 ACACAAATGAGGGCGCAGTGTGG - Intronic
1032813733 7:135449902-135449924 GCAGGAAGGAAGGCACAGAGAGG + Intronic
1032874074 7:136018700-136018722 ACAGAAACCAAGGCCCAGAGAGG - Intergenic
1033136754 7:138791598-138791620 TCTGCAATGAAGCCCCAGTGAGG + Intronic
1034239476 7:149598751-149598773 GCTGCAATGAAGAACCAGTGAGG + Intergenic
1037277382 8:17195325-17195347 GCATAAATGAATGACCTGTGAGG + Intronic
1037748652 8:21665767-21665789 GAAGAAATCAAGGTCCAGAGAGG + Intergenic
1038015112 8:23508226-23508248 ACAGAAATGGCGGCCCAGAGAGG + Intergenic
1038056345 8:23861813-23861835 GCTGCAATAAAGGGCCAGTGAGG - Intergenic
1038503382 8:28063651-28063673 GAAGACATGAAGGCTCAGAGAGG - Intronic
1038693678 8:29785802-29785824 GAAGATAAGAGGGCCCAGTGTGG - Intergenic
1039053484 8:33515177-33515199 AAAGAAATGAAGGCACAGAGAGG - Intergenic
1040388043 8:46926908-46926930 TCAGGAATCCAGGCCCAGTGGGG - Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1041096078 8:54351534-54351556 TCAGAAATGAAGCTCAAGTGAGG - Intergenic
1041152297 8:54948015-54948037 GCAGAAATTAAGGCCAGGCGTGG + Intergenic
1044372897 8:91434519-91434541 GAAGAAATGAAAGCCTAGTATGG - Intergenic
1044531282 8:93310365-93310387 GAAGAAATTAAGGCTCAGCGAGG + Intergenic
1045084295 8:98664335-98664357 GAAGAAATGAAGACCCAGACCGG - Intronic
1046913508 8:119655514-119655536 GAAGAAATGAAGGTCCAGAGAGG - Intronic
1047480330 8:125276033-125276055 GCAGGACAGAAGACCCAGTGCGG - Intronic
1047502621 8:125453977-125453999 CTAGAAATGGAGGCCCAGAGAGG + Intergenic
1047594772 8:126367313-126367335 GAAGAAATCAAGGCTCAGAGAGG - Intergenic
1048306758 8:133289888-133289910 GGAGAAACCAAGGCCCAGAGAGG - Intronic
1048322695 8:133412637-133412659 GATGAAACAAAGGCCCAGTGAGG - Intergenic
1048338838 8:133523447-133523469 GAGGAAATGAAGGCACAGGGAGG - Intronic
1048497923 8:134950555-134950577 AGAAAAATGAAGGCCCAGTGAGG + Intergenic
1048874105 8:138823020-138823042 TCAAAAATGTGGGCCCAGTGGGG + Intronic
1049060971 8:140276064-140276086 TGAGAAATGAAGGCTGAGTGAGG - Intronic
1049710938 8:144063017-144063039 ACAGAGATAAAGGCCCAGTGGGG - Intronic
1051035584 9:12741065-12741087 GCAGAAATGAAGTCACAGCGTGG - Intergenic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051544858 9:18262339-18262361 GAAGGAATGGAGGCCCAGTGTGG + Intergenic
1053292490 9:36890530-36890552 CCAGAAACCAAGGCCCAGAGAGG - Intronic
1053410606 9:37914070-37914092 CCAGAAATGGAGGCCCAGACAGG - Intronic
1053787712 9:41664262-41664284 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1054157414 9:61650505-61650527 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1054175988 9:61875604-61875626 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1054477188 9:65581510-65581532 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1054661551 9:67705204-67705226 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1055709023 9:79038287-79038309 GCAGAGATGAAAGCCCAGTCTGG + Intergenic
1056230977 9:84543419-84543441 GAAGAAACCAAGGCCCAGAGAGG + Intergenic
1057025526 9:91731957-91731979 GCTGAAATGAAGGTCAAATGAGG - Intronic
1057205292 9:93168428-93168450 GGAGAAACCAAGGCCCAGAGAGG - Intergenic
1057321691 9:94019129-94019151 GAAGAAACGGAGGCCCAGAGAGG - Intergenic
1057782934 9:98064649-98064671 GAAGAAATGGAGGACCAGAGGGG + Intronic
1058816655 9:108689818-108689840 GCAGAAAAGAAAGCTCAGAGAGG + Intergenic
1058912874 9:109536957-109536979 TCGCAAATGAAAGCCCAGTGTGG + Intergenic
1059410045 9:114126048-114126070 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1059648157 9:116287687-116287709 GAAGAAAAGAAGGCTCAGGGAGG - Intronic
1059830578 9:118090819-118090841 GAAGAGATTAGGGCCCAGTGAGG + Intergenic
1060709288 9:125841132-125841154 GAAGAAATTAAGGCCCAGAGAGG + Intronic
1060976665 9:127768944-127768966 CCAGAAAGAAAGGCTCAGTGAGG - Intronic
1060992363 9:127856433-127856455 GGAGAAATTGAGGCCCAGGGAGG + Intergenic
1061093785 9:128442435-128442457 GGAGAAATGAAGGTTCAGAGAGG - Intergenic
1061715442 9:132515702-132515724 GCAGAGATGAAGGCAGAGAGAGG + Intronic
1061721187 9:132552401-132552423 GCAGAGTCGAAGGCCCAGTGCGG + Intronic
1061918916 9:133771630-133771652 GCAGAAACTGACGCCCAGTGGGG - Intronic
1061929064 9:133822931-133822953 GCACAAATTAAGGCTCAGAGAGG - Intronic
1062018645 9:134305212-134305234 GGAGAAATCAGGGCCCAGAGAGG - Intergenic
1186194356 X:7096537-7096559 GAAAAAAAAAAGGCCCAGTGTGG + Intronic
1186523808 X:10229169-10229191 GCAGATAGGAATCCCCAGTGAGG - Intronic
1188299899 X:28495647-28495669 ACTGACATCAAGGCCCAGTGGGG + Intergenic
1188523182 X:31060975-31060997 GCAGAAATGTAGGCTCTGTCTGG - Intergenic
1188605669 X:32026403-32026425 GCAGAAATTAAGTCCCATTGTGG - Intronic
1188659626 X:32742904-32742926 GAAGAAACGAAGGCCAAGAGAGG + Intronic
1191881332 X:65846320-65846342 GAAGAAATGAAGGCTCAGTGAGG + Intergenic
1192227288 X:69238142-69238164 GCAGAAACGGAGGCCAAATGGGG + Intergenic
1194586645 X:95743053-95743075 GAAGGGATGTAGGCCCAGTGTGG + Intergenic
1195124604 X:101794482-101794504 GAAGGAATGTAGGCCCTGTGTGG + Intergenic
1196001870 X:110795483-110795505 AAAGAAATGCAGGCCGAGTGGGG + Intronic
1196891105 X:120291715-120291737 GTAGAAATGGAGGCACAGTGAGG + Intronic
1197733606 X:129833179-129833201 GCAGAAATGAAGACTTAGTTGGG - Intronic
1200213455 X:154357022-154357044 GGGGAAATAAAGGCCCAGAGAGG + Intronic