ID: 1003387518

View in Genome Browser
Species Human (GRCh38)
Location 6:5683012-5683034
Sequence ACGTGTTCAGAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003387515_1003387518 4 Left 1003387515 6:5682985-5683007 CCGAGTTTGACATGGCTGTGGGA 0: 1
1: 1
2: 2
3: 25
4: 171
Right 1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 28
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003387518 Original CRISPR ACGTGTTCAGAGAGGGAAGC AGG Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903730902 1:25494540-25494562 ACGTGTTCAGACTGTTAAGCGGG + Intronic
903801999 1:25975933-25975955 CTGTGATCAGAGAGAGAAGCAGG - Intronic
906290823 1:44618195-44618217 ACGGGCTCACAGAGAGAAGCAGG + Intronic
908005043 1:59718947-59718969 AATTGTTCTGAGAAGGAAGCTGG - Intronic
912115692 1:106404452-106404474 ATGTGTTCAGAGACGAAAACCGG + Intergenic
913609619 1:120497332-120497354 ACGAGCTCTGAGAGGGCAGCTGG - Intergenic
913985849 1:143565369-143565391 ACGAGGTCTGAGAGGGCAGCTGG + Intergenic
914204202 1:145513205-145513227 ACGAGGTCTGAGAGGGCAGCTGG + Intergenic
914581571 1:149024512-149024534 ACGAGCTCTGAGAGGGCAGCTGG + Exonic
914704162 1:150157880-150157902 AAGTCTTCAGAGAGAGAGGCAGG + Intronic
915916211 1:159942372-159942394 AGGTGTACAGAGAGGGTGGCTGG - Intronic
917631345 1:176894159-176894181 AAGGGATCAGCGAGGGAAGCTGG + Intronic
917700084 1:177571572-177571594 AGGTGATCAGAGTGAGAAGCTGG + Intergenic
919566903 1:199200198-199200220 ACGCGTTCACTGAGGGAAGAGGG - Intergenic
919664764 1:200281488-200281510 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
920680385 1:208068036-208068058 AGGTGTTCATAGAAGGAAGTGGG - Intronic
921694349 1:218190503-218190525 AGGTGTTCAGACAAGGCAGCTGG + Intergenic
922061957 1:222101343-222101365 AAGTTCTCAGAGAGGGAAGGTGG - Intergenic
922469156 1:225865283-225865305 ACGTGTGCAGCCAGGGATGCGGG - Intronic
922662567 1:227442953-227442975 AGCTGTTCAGTGAGGGAAACAGG + Intergenic
923814178 1:237357305-237357327 ACGTGTTCTGAGAAGGAAGCAGG - Intronic
924826089 1:247540329-247540351 ACTTGTTAAGAGATGGAAACTGG - Intronic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063568136 10:7190727-7190749 GCTTGATCAGAGAGGGTAGCAGG + Intronic
1066532693 10:36357754-36357776 AAGTGTTCCGAAAGGGATGCTGG - Intergenic
1067169655 10:43896320-43896342 ACGTGTTGTGAGAGGGACCCAGG + Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1068416474 10:56729696-56729718 AAATGTTCAGAGAGGGAATGAGG - Intergenic
1069979300 10:72241175-72241197 TGGGGTACAGAGAGGGAAGCAGG + Intergenic
1070644257 10:78190532-78190554 AGGTGTGCAGAGAGGCAAGCAGG + Intergenic
1070704629 10:78628814-78628836 GCGAGTTAAGAGAGGGAAGTGGG - Intergenic
1071144363 10:82550325-82550347 ACATGTTCAGCAAGGGAAGTCGG + Intronic
1071487004 10:86108923-86108945 AGGGGCTCGGAGAGGGAAGCCGG - Intronic
1071739997 10:88347348-88347370 ATCTGTTCAGAGAGGGAACCTGG - Intronic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1072349063 10:94540191-94540213 ACGTGTACAGAGAGTAAAGCAGG - Intronic
1073855739 10:107671211-107671233 ACGTGTTGTGGGAGGGACGCAGG - Intergenic
1076482930 10:130796625-130796647 ACGTGTTCAAAGAAAGTAGCAGG + Intergenic
1076542024 10:131220552-131220574 ATGGGTTCAGAGAGGGAGGGAGG + Intronic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077791857 11:5449675-5449697 GCAAATTCAGAGAGGGAAGCAGG + Intronic
1078624155 11:12938965-12938987 AGGTGTTGAGACAGGGAAGGGGG - Intronic
1078962407 11:16292810-16292832 ACTGGTACAGAGAGGGAACCCGG + Intronic
1079756119 11:24265867-24265889 ATGTATTCAGAAAGGAAAGCTGG + Intergenic
1083222755 11:61264364-61264386 CCATGTTCAGAGAGGGAACACGG - Intronic
1085174207 11:74472532-74472554 TCCTGTGCAGAGAGGGAAACAGG - Intergenic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1085885571 11:80517894-80517916 GCCTGTTAAGAGAGGCAAGCAGG + Intergenic
1088456070 11:110034279-110034301 ATGAGGTCAGAGAAGGAAGCAGG - Intergenic
1088736498 11:112732066-112732088 AGGTGTAAAGAGAAGGAAGCTGG + Intergenic
1089221858 11:116878681-116878703 ACCAGGTCAGAGAGGGAAGTAGG - Intronic
1091267739 11:134283681-134283703 ACGGGTTGGGAGAGGGAAGCAGG - Intronic
1092001822 12:5039002-5039024 GCATGTTAAGAGATGGAAGCAGG - Intergenic
1092036344 12:5338494-5338516 AAGGGTTCAGCCAGGGAAGCGGG - Intergenic
1094236862 12:28177903-28177925 ACGTGTTGAGGGAGGGAGGTGGG + Intronic
1094641817 12:32283113-32283135 AGGTTTTCAGGGAGGGAAGATGG + Intronic
1095039822 12:37428293-37428315 ACGTGTTCGGGGAGGGAACCAGG + Intergenic
1096207776 12:49737865-49737887 TAGTGTTGAGAGACGGAAGCTGG - Intronic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1099919229 12:88936442-88936464 ACGTGTTCAGAGATGGTAAATGG - Intergenic
1101752656 12:107595399-107595421 GTGTATTCAGAGTGGGAAGCAGG + Intronic
1101788618 12:107908744-107908766 ACATTTTCAGAGAAGGAAGAAGG - Intergenic
1103853937 12:123951602-123951624 AAGTGCACAGAGAGGGCAGCAGG - Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1107840493 13:44451984-44452006 ACTTGTTCAGTCAGGAAAGCAGG + Intronic
1109482590 13:62974991-62975013 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1110234380 13:73201177-73201199 AAGAGTTCAAAGAGGGAAGCTGG - Intergenic
1113492139 13:110700439-110700461 GCGTGTGCAGAGAGGGGAGGCGG + Intronic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114791535 14:25664917-25664939 ACGTGTTCCAAGAGGTAAGATGG + Intergenic
1116400466 14:44500271-44500293 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1117442173 14:55770291-55770313 AAGAGTTCAGAGATGGAAGATGG + Intergenic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1122111832 14:99508682-99508704 AAGTGTACAGAGAGGGAATGGGG + Exonic
1123046256 14:105517661-105517683 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1125765982 15:42136699-42136721 ACGTGTTGAGTGAGAGAAGCTGG + Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129319639 15:74767436-74767458 AGAGGTTCAGAGAGGGAAGATGG + Intergenic
1130051804 15:80490108-80490130 AAGTGGTGAGAGAGAGAAGCTGG + Intronic
1130568431 15:85019065-85019087 ACCTCTTTAGAGATGGAAGCAGG - Intronic
1131110393 15:89761150-89761172 ACGTGTCCAGAGAGGGCAAACGG - Intronic
1132524124 16:405949-405971 ACGTGGTCAGGAAGGGGAGCAGG + Intronic
1133130180 16:3671897-3671919 ACGTGTGCTAAGAGGGAAGCAGG + Intronic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1134872787 16:17666923-17666945 ACTTCTTAAGAGAGGGATGCGGG - Intergenic
1136732507 16:32429767-32429789 TCGTTTTCAGAAAGGGAAGCCGG + Intergenic
1140245662 16:73245763-73245785 AGGTGAGCAGAGAGGGTAGCTGG + Intergenic
1203020574 16_KI270728v1_random:399835-399857 TCGTTTTCAGAAAGGGAAGCCGG - Intergenic
1203038909 16_KI270728v1_random:672993-673015 TCGTTTTCAGAAAGGGAAGCCGG - Intergenic
1143375251 17:6463408-6463430 ACGAGTGCAGGGAGGGAGGCAGG + Intronic
1143967620 17:10768051-10768073 ACTTCTGCAGAGAGGGAAACTGG - Intergenic
1147199379 17:38789765-38789787 ACGTGCTTTGAGAGGGATGCTGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1150252473 17:63714749-63714771 ACGTGTGCTGTGAGTGAAGCTGG + Intronic
1152903185 17:82956917-82956939 AGGTGTTCAGAGCAGGAACCCGG + Intronic
1153243815 18:3054333-3054355 ACAAGGTCAGAAAGGGAAGCAGG - Intergenic
1155717345 18:28961456-28961478 ACATGTTGAGCAAGGGAAGCAGG - Intergenic
1161319305 19:3633658-3633680 ACCGGGTCAGAGAGGGCAGCTGG - Intronic
1162462008 19:10818873-10818895 CCTAGCTCAGAGAGGGAAGCTGG - Intronic
1167118411 19:47501542-47501564 GCATGTCCAGAGAGGGAAACAGG + Intronic
1167403608 19:49289397-49289419 ACGTGTTATGGGAGGGAACCAGG + Intergenic
1168094441 19:54106715-54106737 TTATGTTCAGAGAGGGAAGGGGG - Intronic
927182223 2:20454808-20454830 ATGTTCTCAGAGAGGGAGGCCGG - Intergenic
928538804 2:32264956-32264978 ACCAGTTCAGAAAGGGAAGATGG + Intronic
930691492 2:54370303-54370325 ACATTTTCAGAGAAGGAAGCAGG + Intronic
933367185 2:81367741-81367763 ACGTGTTGAGGGAGGGACCCGGG - Intergenic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
937436736 2:121887593-121887615 AAGTGCTCAGACAGGCAAGCGGG + Intergenic
937851135 2:126637532-126637554 AGGTGGCCAGAGACGGAAGCAGG + Intergenic
938912621 2:135899133-135899155 AAGTGTTGGGAGAGAGAAGCAGG + Intergenic
941272421 2:163447635-163447657 ACTTGTTCTGAGAGGCAAGAAGG + Intergenic
942240857 2:173963897-173963919 GCGGGTTCAGAGAGGGAGACAGG + Intronic
942571834 2:177322934-177322956 ACTTGTCCAGACAGGGAAGATGG + Intronic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945989763 2:216385730-216385752 ACGTGTTAAGATGGGGAAGCTGG - Intergenic
947509425 2:230737376-230737398 AGGTGTCCTGAGAGGGTAGCGGG - Intronic
948142081 2:235680855-235680877 AGGTGTTCAGAGGCGGAAGCTGG - Intronic
948621399 2:239237094-239237116 AGGTGTGCAGACAGGGAAGGAGG + Intronic
1169045778 20:2533445-2533467 ACTTGCTCTGAGAGGGAATCTGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170106780 20:12759900-12759922 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171571608 20:26256387-26256409 ACATGTTCGGGGAGGGAACCAGG + Intergenic
1171573466 20:26276204-26276226 ACGTGTTCGGGGAGGGAACCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171837398 20:30169207-30169229 ACGTGTTCGGGGAGGGAACCAGG + Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173719406 20:45241061-45241083 ATGTGTTCAGAGAATGAATCAGG - Intergenic
1174517713 20:51105698-51105720 AGGTTTTCAGAGAGAGAAACTGG - Intergenic
1177704406 21:24682655-24682677 ACGTGTTGTGAGAGGGACCCAGG - Intergenic
1180539937 22:16435356-16435378 TCGTTTCCAGAAAGGGAAGCTGG - Intergenic
1180573793 22:16753405-16753427 ACTTGTTCGGGGAGGGAACCAGG + Intergenic
1181902564 22:26168722-26168744 TCCTGCTCAGATAGGGAAGCGGG + Intergenic
1182989380 22:34752311-34752333 ATGAGGTCAGAGAGGTAAGCAGG - Intergenic
1185417284 22:50717160-50717182 ACGTGTGCAGAGAGCTCAGCGGG + Intergenic
954382875 3:50228912-50228934 ACCTGTTGCGGGAGGGAAGCTGG - Intronic
960179513 3:114558791-114558813 ATGTGTTCAGAGAAGGAATCAGG - Intronic
962083675 3:132167587-132167609 ATGTGTTCAGAGAGGGGAGGAGG + Intronic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
964097543 3:152950413-152950435 ACAGGTTTAGAGAGGGAAGGAGG - Intergenic
964932962 3:162048171-162048193 TAGTGTTGGGAGAGGGAAGCTGG + Intergenic
965500151 3:169446251-169446273 ACGTGTTGTGGGAGGGAACCAGG + Intronic
965617653 3:170611425-170611447 ATGTGGTCAGAGAGGTAAGTTGG - Intronic
965637429 3:170797858-170797880 ACGTGTTGAGGGAGGGACCCAGG - Intronic
967149059 3:186631457-186631479 AGGTGTTCAGAAAGAGAAGATGG + Intergenic
967729047 3:192890169-192890191 ACCTGTTCTGTGAGGGAAGCAGG - Intronic
968040097 3:195581549-195581571 AGGTGTACAGATGGGGAAGCTGG + Intronic
969115061 4:4866144-4866166 CCCTGTTCAGAGAGGGAATGCGG - Intergenic
971357809 4:25910729-25910751 TCATGTTCAGAGGGGGAAGCTGG - Intronic
972639821 4:40915204-40915226 ACGAGATGAGAGAGGGAAGCAGG - Intronic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
976320048 4:83703882-83703904 AAATGTTCAGAGAGGAAAACTGG - Intergenic
977914415 4:102575487-102575509 AAGAATTCAGAGAGGTAAGCAGG - Intronic
977945404 4:102907535-102907557 TCGTTTCCAGAAAGGGAAGCTGG - Intronic
978016660 4:103753454-103753476 ACGTGTTGTGTGAGGGATGCAGG + Intergenic
978643362 4:110897928-110897950 ACATGTAAAGAAAGGGAAGCAGG - Intergenic
979525384 4:121710792-121710814 ACGTGTTCAGCAAAAGAAGCAGG + Intergenic
984467446 4:180118841-180118863 ACGTGTTGTGAGAGGGACCCAGG + Intergenic
984731581 4:183073477-183073499 ACGGGTTAAGAGAGGCAAGGAGG + Intergenic
986213308 5:5694608-5694630 TCCTGTTCAGAGATGGAAGCAGG + Intergenic
989145468 5:38245361-38245383 AGGTTTCCAGAGAGGGAACCTGG - Intergenic
991609186 5:68433379-68433401 AGGAGTTCAGAGAAGGAAGAAGG + Intergenic
995774762 5:115713101-115713123 ACGTGTTTTGGGAGGGGAGCCGG - Intergenic
997197857 5:131991602-131991624 ACGGGTGCAGAGTGGGAAGGTGG + Intronic
997405887 5:133646369-133646391 ATGAGGTCAGAGAGGTAAGCAGG + Intergenic
997660598 5:135586621-135586643 TCGTGCTCTGATAGGGAAGCAGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999575524 5:152972460-152972482 ACGTGTTTTGGGAGGGAATCAGG - Intergenic
999646487 5:153722727-153722749 ACTGGTTCTGAGATGGAAGCTGG + Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1002029495 5:176417170-176417192 GCCTGTTCACAGAGGGCAGCGGG - Intergenic
1002700671 5:181122352-181122374 AGGTGTTCAGAGAGGGCCTCAGG - Intergenic
1003053140 6:2797633-2797655 ACATGTTCTGGGAGGGGAGCAGG - Intergenic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1007820882 6:44559822-44559844 ACAAGTTCAGAGAGGGAGGCAGG - Intergenic
1009319379 6:62267470-62267492 AAGTGTTCAGAGAAGGAGACAGG + Intronic
1010487409 6:76432139-76432161 ACAAGATGAGAGAGGGAAGCAGG + Intergenic
1010767149 6:79788851-79788873 ACGTGTCCAGTGAGAGAAACAGG - Intergenic
1011731955 6:90273871-90273893 ACTTTTTCAGAGAAAGAAGCTGG - Intronic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1016464713 6:144314042-144314064 AGGGGCTCAGAGAGGGAGGCTGG + Intronic
1016503674 6:144751886-144751908 ACATCTTTAGAGAGGGATGCAGG - Exonic
1017862026 6:158407704-158407726 ACATGCTAAGAGAAGGAAGCCGG + Intronic
1018376579 6:163218789-163218811 ACATGTTGAGAGAGTGCAGCTGG - Intronic
1019560569 7:1654486-1654508 AGGGGCTCACAGAGGGAAGCCGG + Intergenic
1020027141 7:4907111-4907133 ACATCTTCAGAAAAGGAAGCAGG - Exonic
1021823884 7:24527784-24527806 ACGTGTTGTGAGAGGGACCCAGG - Intergenic
1022258948 7:28685603-28685625 ACGTGTAGAGATGGGGAAGCAGG - Intronic
1022327782 7:29347630-29347652 ACGTGTTGAGGGAGGGACCCCGG - Intronic
1024995964 7:55273448-55273470 ACTTCTTCAGTGAGGGAAGATGG - Intergenic
1025285903 7:57660436-57660458 ACATGTTCGGGGAGGGAACCAGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1028011070 7:85645184-85645206 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1028325239 7:89516080-89516102 ATGTGTTCAGAAAGAGAAGGAGG + Intergenic
1028793813 7:94881879-94881901 TAGTGTTGAGAGACGGAAGCTGG - Intergenic
1028866789 7:95722836-95722858 TCGTGATCAGAGAGGTGAGCTGG - Intergenic
1031532343 7:122889914-122889936 ATGTGTTCAGAGTGAGAAGAGGG + Intergenic
1031790936 7:126103567-126103589 ACGAGATCTGAGAGGTAAGCAGG + Intergenic
1035012624 7:155733029-155733051 AGGTGGCCAGAGAGTGAAGCAGG + Intronic
1038401696 8:27288897-27288919 CCTTCTTCAGAGAGGGAAACTGG - Intronic
1045248250 8:100461768-100461790 TCTTGTGCAGAGAAGGAAGCGGG + Intergenic
1046849621 8:118957520-118957542 ATGTGTCCAGAGAGGTGAGCAGG + Intergenic
1047753370 8:127899334-127899356 TCATGTTCAGAGAGGGGAGATGG - Intergenic
1049774766 8:144399126-144399148 ACCTCTTCAGAGAGGAAGGCAGG + Exonic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1054804169 9:69381978-69382000 ACGTGTCCAGAGAGAGGAGAGGG - Intronic
1059763808 9:117364194-117364216 AAGTTATCAGAGGGGGAAGCTGG - Intronic
1060308305 9:122435848-122435870 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1191020978 X:55859714-55859736 ACGTGTTGAGAGAGGGGCCCAGG - Intergenic
1191976828 X:66881971-66881993 ACATGGTCAGAGAGGTAAGGGGG + Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1194755472 X:97733876-97733898 ACTTCTACAGACAGGGAAGCAGG + Intergenic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1196558783 X:117122181-117122203 ACGTGTTGTGAGAGGGACCCAGG - Intergenic
1198279213 X:135125484-135125506 TTGTGTTCAGAGAGAGCAGCTGG - Intergenic
1198291744 X:135247036-135247058 TTGTGTTCAGAGAGAGCAGCTGG + Intergenic
1199928861 X:152497394-152497416 AGGGGTTCAAAGATGGAAGCAGG - Intergenic
1200683629 Y:6242442-6242464 ATGTGTCCAGGGAGGGAACCTGG - Intergenic
1201049006 Y:9911944-9911966 ATGTGTCCAGGGAGGGAACCTGG + Intergenic