ID: 1003388804

View in Genome Browser
Species Human (GRCh38)
Location 6:5694385-5694407
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 382}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003388804_1003388807 0 Left 1003388804 6:5694385-5694407 CCTTTTTTCCTGAATAATAGAAG 0: 2
1: 0
2: 2
3: 23
4: 382
Right 1003388807 6:5694408-5694430 GTTACATTGATTAGAAATTATGG No data
1003388804_1003388809 2 Left 1003388804 6:5694385-5694407 CCTTTTTTCCTGAATAATAGAAG 0: 2
1: 0
2: 2
3: 23
4: 382
Right 1003388809 6:5694410-5694432 TACATTGATTAGAAATTATGGGG 0: 1
1: 0
2: 1
3: 26
4: 262
1003388804_1003388808 1 Left 1003388804 6:5694385-5694407 CCTTTTTTCCTGAATAATAGAAG 0: 2
1: 0
2: 2
3: 23
4: 382
Right 1003388808 6:5694409-5694431 TTACATTGATTAGAAATTATGGG No data
1003388804_1003388810 30 Left 1003388804 6:5694385-5694407 CCTTTTTTCCTGAATAATAGAAG 0: 2
1: 0
2: 2
3: 23
4: 382
Right 1003388810 6:5694438-5694460 AGATTCCTTCATATAAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003388804 Original CRISPR CTTCTATTATTCAGGAAAAA AGG (reversed) Intronic
901279075 1:8018340-8018362 CTTCTAGTATTCAGCACAAATGG + Intronic
902814932 1:18910868-18910890 TTGCTATTATGCAGGAGAAAGGG - Intronic
905178908 1:36155133-36155155 CTTCTAGAAGTCAGGACAAAGGG + Intronic
906813436 1:48852573-48852595 ATTCTCTAATTTAGGAAAAAAGG - Intronic
907360710 1:53912236-53912258 CTACTATTATTTAGTGAAAATGG - Intergenic
908216874 1:61963080-61963102 AGTCTATTATTCAAGAGAAAAGG + Intronic
909056058 1:70822573-70822595 ATTCTATAAGCCAGGAAAAAGGG - Intergenic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
909891905 1:81017767-81017789 GTTATTTTATTCAGAAAAAAGGG - Intergenic
910516448 1:88066590-88066612 TGTCCATCATTCAGGAAAAAGGG - Intergenic
910556095 1:88534895-88534917 CATCTATTATTCAGCAAATGGGG - Intergenic
910908628 1:92209969-92209991 CATTTATTTTGCAGGAAAAATGG + Intergenic
910966913 1:92817075-92817097 CTTATTTTATTCTGGAAAAGAGG + Intergenic
911240720 1:95462915-95462937 CATCTATCAATCAGGAAACAGGG - Intergenic
911385012 1:97163924-97163946 GTTCAATCATTAAGGAAAAATGG + Intronic
912444189 1:109721999-109722021 CTTCTATTTCTCATGTAAAAAGG + Intronic
912904701 1:113691842-113691864 CATCTTTAATTCAGGAATAAGGG + Intergenic
914217436 1:145644948-145644970 CTTCTCTAATTGAGGCAAAAGGG - Intronic
914470005 1:147967633-147967655 CTTCTCTAATTGAGGCAAAAGGG - Intronic
915678530 1:157555432-157555454 CATCCATTATTTAGGAAAAAAGG - Intergenic
915687305 1:157646323-157646345 CTTTTCTTATTCAGCAAAAGGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917461348 1:175233158-175233180 GTTCTGTTATCAAGGAAAAAGGG - Intergenic
918330036 1:183450158-183450180 CGTCTATAATTTAGAAAAAAAGG - Intergenic
918997956 1:191786856-191786878 TTTTTATTTTTCAGTAAAAAGGG + Intergenic
919307286 1:195857737-195857759 ATTCTATTATTTAGAAATAAAGG + Intergenic
919401416 1:197122299-197122321 TTTCTATTATGCAGGAGGAAAGG + Exonic
919574286 1:199287515-199287537 CTTCTAAAATTTAGAAAAAAAGG + Intergenic
919703469 1:200654548-200654570 CTCCTATTATTAAGGAAACTTGG + Intronic
919985142 1:202668687-202668709 CTGCTTTTATTCTGGAAAATGGG - Intronic
920943976 1:210511292-210511314 ATTACATAATTCAGGAAAAACGG - Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921788030 1:219256105-219256127 CTTCTATAGTAGAGGAAAAAAGG - Intergenic
921832852 1:219747522-219747544 CTTCTGTGATTCAGTAATAAAGG - Intronic
923772576 1:236950486-236950508 CTTCTGTTATTCAAGAATGAAGG - Intergenic
1063123712 10:3122754-3122776 CTTCTATTGTTCAGAAAATTTGG + Intronic
1063640476 10:7825115-7825137 CTAAAATTATGCAGGAAAAAAGG - Intronic
1064099412 10:12450836-12450858 CTTCTTTTATTCTGGAACAATGG - Intronic
1064158921 10:12926545-12926567 GTTCTATTGGGCAGGAAAAAAGG + Intronic
1064574003 10:16725830-16725852 CATCTAGTATGCAGGAACAAAGG + Intronic
1064846650 10:19662908-19662930 ATTCTATGATTAATGAAAAATGG - Intronic
1065692914 10:28353805-28353827 GTTCAATAATTCAGGAGAAATGG - Intergenic
1068206011 10:53854518-53854540 CTTTTATTCTTCATGAAAATTGG - Intronic
1068508639 10:57936060-57936082 TTTGTATTATTCATGAATAAAGG - Intergenic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1069792541 10:71032175-71032197 CATCTATTATTTAGGAAAGGAGG + Intergenic
1069959459 10:72071078-72071100 CTTCTATGATTCAGGAAAGAAGG + Intronic
1070109662 10:73472695-73472717 CTTTTATTTTTCAGAAAAAATGG - Intronic
1071017894 10:81020058-81020080 CTTTTATTATTGAGCATAAAAGG - Intergenic
1071244572 10:83749235-83749257 CCTCTATTAGAAAGGAAAAAAGG + Intergenic
1073415638 10:103379439-103379461 GTTCTGTTAGTAAGGAAAAAGGG + Intronic
1073677658 10:105666640-105666662 CTTCTATTCTTCTGAAAAGAAGG - Intergenic
1074045615 10:109835952-109835974 CTTCTAATATTGAAGCAAAACGG + Intergenic
1074210860 10:111333720-111333742 GTTCTTTTATTCACAAAAAAAGG - Intergenic
1075977361 10:126707266-126707288 CTTATATTTTACATGAAAAATGG - Intergenic
1076081580 10:127586376-127586398 ATTCTATTAGTGAGGAAAATGGG + Intergenic
1076194418 10:128506352-128506374 CTTCTAGTTTTCAGGAAATATGG - Intergenic
1077986992 11:7362556-7362578 ATTCCATTAGTCAGGAAGAAGGG + Intronic
1078927180 11:15885562-15885584 CTTCTATTATTCCTGCAAATTGG + Intergenic
1079189238 11:18264366-18264388 CTTCTATTTTTCAGTGAAATAGG - Intergenic
1079561813 11:21830552-21830574 CTTCACTTTTTCAGGTAAAAGGG - Intergenic
1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG + Intergenic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1080808231 11:35675980-35676002 GTTCTTTTACTAAGGAAAAATGG + Intronic
1081189689 11:40088399-40088421 CTTCTTTTATTCATGTAGAAGGG - Intergenic
1081255014 11:40881955-40881977 CTTCTAGTATGAAGCAAAAATGG - Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1088001541 11:104887750-104887772 CTCCTATAATTTAGAAAAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089810358 11:121126382-121126404 CTCCTAATATTTAAGAAAAAGGG - Intronic
1093120415 12:15264761-15264783 ATTTTATTTTTCAGTAAAAACGG + Intronic
1093617916 12:21250655-21250677 CTTCAATATTTCAGTAAAAATGG + Intergenic
1094106565 12:26817993-26818015 CTTCTATTAGTATGGAAGAAGGG + Intronic
1094203084 12:27813026-27813048 GATCTATTACTAAGGAAAAAAGG + Intergenic
1095654464 12:44652592-44652614 CTTCAATCATTAGGGAAAAATGG + Intronic
1096129477 12:49146272-49146294 CTTCTATTTTTTTGGAAACACGG - Intergenic
1096205196 12:49715650-49715672 CTTCTATCATGTGGGAAAAATGG - Intronic
1097356908 12:58612431-58612453 TTTCTATTTTTCAGTAGAAACGG - Intronic
1098002398 12:65959353-65959375 TTTCTTTTGTTCATGAAAAAAGG - Intronic
1098131980 12:67360719-67360741 CTTCTAATATGAAGGAGAAAAGG + Intergenic
1098951914 12:76648495-76648517 TTTCTCTTTTTCAGAAAAAAAGG + Intergenic
1098953325 12:76664067-76664089 TTTTTATTACTCATGAAAAAGGG + Intergenic
1099350104 12:81556438-81556460 CTTCTAATGTGCATGAAAAAAGG - Intronic
1099788632 12:87300764-87300786 CTTCTATTACACAAGAAGAAAGG + Intergenic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1100600440 12:96107969-96107991 ATTCTCTCATTCTGGAAAAACGG - Intergenic
1100994322 12:100286458-100286480 TTTCTTTTTTTCAAGAAAAAAGG - Intronic
1101884929 12:108654514-108654536 CTTCTGTTATTCTAGGAAAATGG - Intronic
1104199221 12:126571704-126571726 CTTCTAGAATTCAGTATAAAGGG - Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105664960 13:22543809-22543831 CTCCTACGATTCAGAAAAAAAGG - Intergenic
1107537302 13:41348337-41348359 CTTCTATTTTTTAGTAGAAACGG + Intronic
1109364014 13:61331848-61331870 CTTGTATTCTACTGGAAAAAAGG - Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1110603864 13:77408552-77408574 GTTATAATATTCATGAAAAAAGG - Intergenic
1111051689 13:82890718-82890740 AGTCTATTATGCAGTAAAAATGG + Intergenic
1111179699 13:84647404-84647426 CTTCTAACATTTAGGAGAAAAGG + Intergenic
1111184931 13:84720994-84721016 TGTCTATTATTTATGAAAAAAGG + Intergenic
1111234514 13:85391156-85391178 CTCCTGTTATGCAGGGAAAATGG - Intergenic
1111634019 13:90880529-90880551 CATCTATTGTTCTAGAAAAATGG + Intergenic
1113145865 13:107206614-107206636 TTCCTATTATTCACAAAAAAGGG - Intronic
1113411016 13:110089926-110089948 CTTCTTTTCTCCAGGAAATATGG - Intergenic
1114767925 14:25395478-25395500 GTTCATTTATTCATGAAAAAAGG - Intergenic
1115522670 14:34248529-34248551 TTTCTATTATTGTGGAAGAAAGG + Intronic
1115899644 14:38130217-38130239 CATCTATTTTCCAGGAACAAAGG + Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1119081262 14:71696435-71696457 CTTCTAAAATGCAAGAAAAAGGG - Intronic
1120096479 14:80394490-80394512 CATCTATTATTGAGAAACAAAGG - Intergenic
1120135539 14:80864386-80864408 CTTCTATATTTCAGAAAAGAAGG + Intronic
1120343163 14:83247205-83247227 ATTATTTTATTCAGGAAAAATGG + Intergenic
1120558603 14:85961257-85961279 GTTCTATTTTACAGTAAAAAAGG - Intergenic
1120654633 14:87174988-87175010 CTTCTATTTTTAAAGAAATAGGG - Intergenic
1120845736 14:89123314-89123336 CTTCTATGAATAATGAAAAAAGG - Intergenic
1120853617 14:89193541-89193563 CTTCTGTTATTCATCAAAGATGG + Intronic
1121230708 14:92355581-92355603 CTTCTAGTATTTAGGCAAAGAGG - Intronic
1121836733 14:97098846-97098868 CATTTATTCTGCAGGAAAAAAGG - Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123777209 15:23591499-23591521 CTTCTATTGTTCTGGAGAAGGGG - Intronic
1123788821 15:23699463-23699485 CTGCTATGATTCCGAAAAAATGG - Intergenic
1128164558 15:65452045-65452067 CTTCTATGATACAGGATACACGG - Exonic
1129654040 15:77510926-77510948 ATTCAATTATTCAGGAAGGAAGG - Intergenic
1130128951 15:81120030-81120052 TTTTTATTATTTAGGAAAACTGG - Intronic
1131452287 15:92552787-92552809 CTAAGATTATTCAGGAATAAAGG + Intergenic
1131501417 15:92970648-92970670 CATGTATCATTAAGGAAAAAAGG - Intronic
1133180757 16:4052432-4052454 CTCAAATTATTCCGGAAAAAAGG + Intronic
1133900330 16:9968095-9968117 CTCCCATTTTGCAGGAAAAAAGG + Intronic
1135656331 16:24253609-24253631 TTTCTCTTATTCAGCAAAACTGG + Intergenic
1135761378 16:25140947-25140969 CCTCTATTCTTAAGGAGAAAGGG + Intronic
1137736132 16:50725225-50725247 CTTCCATTAATAAGGAAGAAAGG + Intronic
1138132172 16:54489730-54489752 GTTTTATTATGCAGGCAAAATGG - Intergenic
1138683761 16:58706654-58706676 CTTACATTTTTCAAGAAAAATGG - Intergenic
1138952594 16:61931581-61931603 TTTCTAATATCCAGGAAAAGTGG - Intronic
1139129482 16:64123825-64123847 AATCTGGTATTCAGGAAAAATGG + Intergenic
1140429598 16:74890541-74890563 CTTTCATTATTTAGGAAAAGAGG - Intronic
1141288003 16:82690701-82690723 TTTCTTTTATTCATGAACAACGG - Intronic
1141413015 16:83848850-83848872 TTTATATTGTTCAGTAAAAAGGG - Intergenic
1142524861 17:533005-533027 CTTCGATTCTTCATTAAAAAAGG - Intronic
1143049358 17:4111152-4111174 GCTCTATTTTTTAGGAAAAAAGG + Intronic
1146896755 17:36547044-36547066 CATTTATTTTTCATGAAAAAAGG + Intronic
1147412184 17:40261625-40261647 CTTCCTTTATTCAGGGCAAAGGG - Intronic
1149055664 17:52361256-52361278 CTTATATTAGACAAGAAAAATGG + Intergenic
1149201957 17:54196692-54196714 ATACAATTATTCAGGAAGAAAGG + Intergenic
1149455947 17:56788701-56788723 ATTCTATTAATCAAGACAAATGG - Intergenic
1150168025 17:62963635-62963657 TTTCTAATTTCCAGGAAAAATGG + Intergenic
1153279625 18:3401963-3401985 CTTCTAAGATTCAGGATATATGG - Intergenic
1153488066 18:5621391-5621413 TTACTATAATTCAGGAAACATGG + Intronic
1155065489 18:22265569-22265591 CTCCTATTGATCAGGAAAGAAGG + Intergenic
1156145905 18:34177535-34177557 GTTCTGATATTCAGCAAAAAGGG - Intronic
1156183836 18:34638736-34638758 ATTCCACTATTCAGGAAAATAGG + Intronic
1156657106 18:39301582-39301604 CTTATATTATCCATGAAATATGG - Intergenic
1158044443 18:53138472-53138494 CTTCTATTTTTCTGAAGAAAAGG + Intronic
1158066810 18:53420399-53420421 CTTCTTTATTTCAGGAAACAGGG + Intronic
1158149130 18:54347102-54347124 ATTCTCTAATTCAGAAAAAAAGG - Intronic
1159752536 18:72320276-72320298 CTTCTGTGATTCTGGAAATACGG - Intergenic
1160040097 18:75337420-75337442 CTTCTGTTAGGAAGGAAAAAGGG + Intergenic
1166237540 19:41467399-41467421 CTGCTAGTATCCAGGAAGAAAGG - Intergenic
1166245580 19:41523226-41523248 CTCCTAATATCCAGGAAGAAAGG - Intergenic
1168106781 19:54170371-54170393 CTTGTATTTGTGAGGAAAAAGGG + Intronic
1168318816 19:55496471-55496493 ATATTATTATTCAGGAAAAGGGG - Intronic
1168632747 19:57970197-57970219 CTTCTTATTTACAGGAAAAAAGG - Intronic
926726128 2:15999413-15999435 CTTCTTTTCTCCAGGGAAAATGG + Intergenic
927112050 2:19870390-19870412 CATCTATTATCCTGGAAGAAGGG - Intergenic
927346860 2:22054408-22054430 TTTCTTTTTTTTAGGAAAAATGG + Intergenic
928914135 2:36453960-36453982 CCTTTATGATTCAAGAAAAAGGG + Intronic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930532453 2:52606977-52606999 CTTCCATTTTTCAAGTAAAATGG - Intergenic
930673433 2:54175758-54175780 TTTCTATTACTAAAGAAAAAAGG - Intronic
931492303 2:62761657-62761679 TTTCTATTATTATGGAAGAATGG + Intronic
931793619 2:65688773-65688795 ATTTTATTATACAGGCAAAATGG + Intergenic
931891341 2:66675841-66675863 CTTTCATCATTCAGGCAAAATGG + Intergenic
932479421 2:72029897-72029919 TATCTTTTATTCAGGAGAAATGG + Intergenic
933423052 2:82076390-82076412 CTTCTAGGATGCAGGAAAACTGG + Intergenic
933434656 2:82232937-82232959 TTTCTATTATTTATTAAAAATGG - Intergenic
933537796 2:83598504-83598526 TCTCTAGTATTAAGGAAAAATGG + Intergenic
937665330 2:124480886-124480908 CTTCCTTTCTTCAGGAAAATTGG + Intronic
937816303 2:126254408-126254430 ATTCTACTATTGAGGAAAACTGG - Intergenic
938124229 2:128660252-128660274 CTTTTATCATTCAAGGAAAATGG - Intergenic
940822416 2:158371788-158371810 ATTTTATTTTTCAGTAAAAAAGG - Intronic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
941208398 2:162603986-162604008 CTTCAATTACTAAGGAAACATGG + Intronic
942555796 2:177171210-177171232 CTTCTACTGTTCAGGGAGAAGGG - Intergenic
942809323 2:179978527-179978549 ATTGTATTATTAAAGAAAAATGG - Intronic
943105386 2:183540561-183540583 CTTCCATATTTTAGGAAAAAAGG + Intergenic
944042505 2:195371847-195371869 CTTCTTTTATTATGGAGAAAGGG - Intergenic
944768946 2:202893996-202894018 GTTCTCTTATTCAGGAAACTTGG - Intronic
944881328 2:204015883-204015905 TTTCTAATATTCAGAAAAATTGG - Intergenic
944892676 2:204134007-204134029 CTCAAATCATTCAGGAAAAAGGG - Intergenic
945129997 2:206560597-206560619 TTTCTACTACTAAGGAAAAAGGG + Intronic
945655944 2:212624261-212624283 TTTTTTTTAATCAGGAAAAAAGG + Intergenic
946358385 2:219203779-219203801 CTTCTTTTATTCAGGAAGCAAGG + Intronic
1169376241 20:5068761-5068783 GTTCTATTACTAAAGAAAAAGGG + Intronic
1169584115 20:7060585-7060607 CATCTATTTTTCAGAAAATATGG + Intergenic
1169590614 20:7137174-7137196 CTTCTATCATCCAGGAAACTTGG + Intergenic
1170307319 20:14952974-14952996 CTTCTATTTTTAAGAAAAGAGGG + Intronic
1174004908 20:47402866-47402888 CTTCTGTTATTAAAGAAAGAAGG - Intergenic
1174058253 20:47814581-47814603 GTTCTATTACTAAGGAAGAAGGG - Intergenic
1174806765 20:53610478-53610500 TTTCTATTAGTAACGAAAAAAGG + Intergenic
1177405413 21:20661376-20661398 CTGCTATTATCCAGAAGAAATGG + Intergenic
1179137068 21:38688997-38689019 GTACTATTATTCAGAAAAACTGG + Intergenic
1180111113 21:45652147-45652169 CTTATATTATTCAGACAGAATGG + Intronic
1181791411 22:25269957-25269979 ATTAAATTAATCAGGAAAAAAGG - Intergenic
1181827106 22:25526068-25526090 ATTAAATTAATCAGGAAAAAAGG - Intergenic
1182864588 22:33592451-33592473 CTTTGATTATCCTGGAAAAAAGG - Intronic
1182897040 22:33867522-33867544 GTTCTATTATTCACGACAAGGGG + Intronic
1184313157 22:43661766-43661788 CTTATATTAAACAGGAAAGAGGG + Intronic
949133775 3:537339-537361 CTTTTATTATTCAGTAAATCTGG - Intergenic
949783172 3:7712513-7712535 CTACTGTAATTCAGGAAAGAGGG - Intronic
950359409 3:12439940-12439962 CTTCCAGTATTGTGGAAAAATGG - Intergenic
953149861 3:40315032-40315054 CTTCCATTATCCAGATAAAAAGG - Intergenic
954726310 3:52613890-52613912 CTTTTAAAGTTCAGGAAAAAGGG - Intronic
955028796 3:55196582-55196604 GTTCTCTTATTGAGAAAAAAAGG - Intergenic
955100247 3:55841978-55842000 GTTCCCATATTCAGGAAAAAGGG + Intronic
955167761 3:56531211-56531233 CATCCTTTATTCTGGAAAAATGG - Intergenic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
956039702 3:65132974-65132996 CTCCTATTAGACAGGGAAAAGGG - Intergenic
956280989 3:67556534-67556556 GCTCTATTATTCAGGAAGAGCGG + Intronic
957495796 3:80990135-80990157 CTGCAATAACTCAGGAAAAATGG - Intergenic
958570239 3:95871524-95871546 CTTTTATTATTCCCTAAAAATGG - Intergenic
959412776 3:106046159-106046181 CTTCTTACATTCAGGAAAGAAGG - Intergenic
959622326 3:108411766-108411788 CTGCTATTAAACAGAAAAAAAGG + Intronic
959780382 3:110225158-110225180 CTTCCTTTATTCTGAAAAAAAGG - Intergenic
961267437 3:125655255-125655277 CTTCTATAATTAAAAAAAAAAGG + Intergenic
961772398 3:129259547-129259569 CTTTCATTATTCTGGAAATATGG - Intronic
962163598 3:133025613-133025635 ATTCTATTACTAAGCAAAAAAGG - Intergenic
962590720 3:136887374-136887396 CTGCTATTTATCAGGAGAAAAGG - Intronic
962674792 3:137747274-137747296 GTTCTATTAATAAGGAAGAATGG + Intergenic
963266794 3:143247782-143247804 CCACTATTATCAAGGAAAAAAGG + Intergenic
963612816 3:147493598-147493620 CTAATATTATTCAGAGAAAAGGG - Intronic
964669859 3:159213083-159213105 CTTCTATTGTACAGGGAAAGGGG + Intronic
965544531 3:169902107-169902129 TTTCTAATATAAAGGAAAAACGG + Intergenic
965792207 3:172401717-172401739 CTTTTATTTTTCAGGAAAATGGG + Intergenic
965915404 3:173840193-173840215 ATACTATCATTCAAGAAAAAGGG + Intronic
965923868 3:173953470-173953492 CTACCATTAATCAGGATAAATGG - Intronic
965994751 3:174867789-174867811 CTATTATTATTCTTGAAAAAAGG - Intronic
966111969 3:176414117-176414139 CCTCTCTTATTTAGCAAAAAAGG + Intergenic
966415567 3:179686232-179686254 CTTGTACTTTGCAGGAAAAAAGG + Intronic
966558131 3:181286848-181286870 CTTTTTTTTTTCAGGAACAATGG - Intergenic
967719758 3:192803320-192803342 ATTCTAATATTCAGGAGATAGGG + Intronic
967755143 3:193160295-193160317 GTTCTATTAGTAAGGAAAAATGG - Intergenic
967874699 3:194259912-194259934 AATCTGTTATTAAGGAAAAAGGG - Intergenic
969712653 4:8852895-8852917 CCTGTTTTATTCAGGAATAAGGG - Intronic
970200277 4:13597720-13597742 TTTCACTTCTTCAGGAAAAAAGG + Intronic
970484931 4:16515596-16515618 CATCTATTATTAAGCAAGAATGG + Intronic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971412741 4:26392466-26392488 TTTCTATTAAGCAGTAAAAAAGG + Intronic
972240562 4:37187421-37187443 CTTCCACTTTTCAGGACAAAAGG + Intergenic
972687978 4:41369442-41369464 GTTGTATTCCTCAGGAAAAAGGG + Intronic
972825184 4:42750008-42750030 CTTCTGTTAGTCAGAAAGAAGGG + Intergenic
973187274 4:47345117-47345139 ATTCAATTGTTCAGGAAAGAGGG - Intronic
974310154 4:60195977-60195999 TTTCTATGATGCAGGAAAATAGG + Intergenic
974384072 4:61182174-61182196 CTTGCATTATTCAGGAATCAAGG - Intergenic
974636121 4:64565754-64565776 CTGCTATGATTCTGAAAAAATGG + Intergenic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
978385199 4:108171059-108171081 CTTCTAATCTTCAGGAAACCTGG - Intergenic
978732114 4:112039823-112039845 ATTCTATTATTAAGGAAGGAGGG + Intergenic
979786759 4:124724440-124724462 TTTCTAATATTCAGCAAAAGGGG + Intergenic
980095044 4:128481104-128481126 ATTCTATTACTCTGGAAGAAGGG - Intergenic
980309774 4:131111408-131111430 ATTCCATTATTCAGTGAAAATGG + Intergenic
980466848 4:133197789-133197811 CTTCTTTTGATCATGAAAAAAGG + Intronic
980905763 4:138947313-138947335 CTTCTATTATAAAGGAAGACAGG + Intergenic
980951448 4:139382776-139382798 CTTCTATTATTCTATAAAACTGG - Intronic
981521889 4:145671336-145671358 CTTTTATAGTACAGGAAAAATGG + Intergenic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983472925 4:168178629-168178651 CTTCTAATTTTCAGTAAGAATGG + Intronic
984246653 4:177283039-177283061 GTTCTATTATCCAGGAAGAAGGG - Intergenic
985254047 4:188052340-188052362 CTTCAATATTTCAAGAAAAAGGG + Intergenic
985826597 5:2196419-2196441 CTTCTTTTCTTCAGCAAAACAGG - Intergenic
986452237 5:7878127-7878149 ATTCGATGATTCAGGAAGAAAGG + Exonic
986682918 5:10250132-10250154 CTTCTATTATCCAGGAAGCCGGG - Exonic
986824859 5:11509432-11509454 TTACTATTATGTAGGAAAAATGG - Intronic
988014596 5:25537509-25537531 CTTCTCTCATTCAAGAAAACTGG + Intergenic
988025510 5:25682615-25682637 CTGGTATTATGCAAGAAAAAAGG - Intergenic
988930935 5:36035049-36035071 CTTTTATTTTTCAGGAAATCTGG + Exonic
988934801 5:36071190-36071212 CTTTTATTTTTCAGGAAATCTGG + Intronic
989748846 5:44866502-44866524 CTTATATTTTTCATGAAAAATGG - Intergenic
990041857 5:51386551-51386573 CTTCTGTTATTCCTGAAAGATGG + Intronic
991911241 5:71563446-71563468 CTTATTATATTCAGGGAAAAAGG + Intronic
992587806 5:78259444-78259466 CTTCTATTTGACAGGAAAATAGG + Intronic
992757955 5:79926656-79926678 CTACTTTCCTTCAGGAAAAAAGG + Intergenic
993100098 5:83527480-83527502 CTTCTATTAGTCAAATAAAAGGG + Intronic
993102033 5:83552288-83552310 CTTCTATTAATCAGCAAATTTGG + Intronic
993452595 5:88091111-88091133 ATTTAATTATTCAGGAACAAGGG + Intergenic
993656701 5:90586577-90586599 CTTCCAGTTTACAGGAAAAATGG - Intronic
993814083 5:92519215-92519237 CTTCAATCAATCAAGAAAAAGGG + Intergenic
995397404 5:111702258-111702280 CTTCTATGATTCTGGAGAAAAGG - Intronic
995997625 5:118320625-118320647 CATCTATTATCCATGAAAGAGGG + Intergenic
998096962 5:139401496-139401518 GTTGTATGTTTCAGGAAAAATGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1000224469 5:159246756-159246778 CTTCTGTTAGTCCAGAAAAATGG + Intergenic
1001459349 5:171896028-171896050 CTCCTGTTATTCAGGAAATGAGG - Intronic
1002377762 5:178800410-178800432 ATTCTATTATTGAGGAAGGAAGG - Intergenic
1002708987 5:181182836-181182858 CTTCTATGTTTCAGTAGAAATGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003841623 6:10126492-10126514 CTCCTATAATGCAAGAAAAAGGG - Intronic
1003935687 6:10973000-10973022 CTTCTGTTAATAAGGAAACAGGG + Intronic
1004120561 6:12817711-12817733 GTTATATTTTTCAGGAAAGATGG + Intronic
1004825345 6:19414299-19414321 CTTATTTTATTCATTAAAAAGGG - Intergenic
1005012503 6:21349189-21349211 CATTGATTGTTCAGGAAAAAAGG - Intergenic
1005128420 6:22474742-22474764 CTTCTAGTTTTCTGGAAGAAAGG + Intergenic
1007019673 6:38506828-38506850 TGTATTTTATTCAGGAAAAATGG - Intronic
1007033808 6:38654330-38654352 ATTCTATTACTAAGGAAGAAAGG - Intergenic
1008428371 6:51385759-51385781 CTTCAATTATTCAGCAAAATAGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009285190 6:61806732-61806754 CTTCTATTATTTCAAAAAAAAGG + Intronic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1009591665 6:65680533-65680555 TTTCTAAGATTCAAGAAAAATGG + Intronic
1010428466 6:75751079-75751101 TTTCTACAATTAAGGAAAAAAGG - Intronic
1010760390 6:79715947-79715969 CTTTTGTCATTCAGGAAAATAGG - Intergenic
1011041739 6:83036993-83037015 CTTCCATTATTCAAAAAAAAAGG + Intronic
1011784822 6:90831853-90831875 ATTCTATTATAAAGGAATAAGGG - Intergenic
1012140544 6:95621523-95621545 CATATGTTATTAAGGAAAAATGG + Intergenic
1012347016 6:98201827-98201849 CTTTTATTTGTCAGGAGAAAGGG - Intergenic
1013385815 6:109629559-109629581 TTTATAATATTCAGGAAAGATGG - Intronic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1014174624 6:118318307-118318329 CATTCATTTTTCAGGAAAAAAGG + Intergenic
1014205118 6:118649007-118649029 CTTCCAATTATCAGGAAAAAAGG + Intronic
1014314811 6:119850575-119850597 CTTCAATTTTTCATGCAAAAGGG - Intergenic
1014467544 6:121774938-121774960 TTTCTATTATTCTAGTAAAAAGG + Intergenic
1014726924 6:124982371-124982393 CTTCTATTTTTCAGTAAAGTTGG - Intronic
1014762051 6:125367213-125367235 CATTTATTACTCAGGCAAAAAGG + Intergenic
1016088739 6:139948483-139948505 CTTATATTAGAAAGGAAAAAAGG + Intergenic
1016188791 6:141234137-141234159 CTTATAATATTAAGGCAAAATGG - Intergenic
1016651518 6:146466531-146466553 CTTTTATTTTTCTGGAATAATGG + Intergenic
1020583308 7:10032699-10032721 TTGCTATTATTCACAAAAAAGGG + Intergenic
1022635238 7:32126135-32126157 TTTCTTTTATGCAGGAATAATGG - Intronic
1026433161 7:70368430-70368452 CTTCTATTACCCAGGAAAATAGG - Intronic
1027893019 7:84001371-84001393 CATCTGTGATTCAGGATAAAGGG + Intronic
1028580038 7:92399161-92399183 CTTCTTTTTGTCAGCAAAAAGGG - Exonic
1028691346 7:93656191-93656213 CTTTTATTATTCTGATAAAATGG + Intronic
1030601535 7:111598519-111598541 CATTTATTATTCTGGAAAAAGGG + Intergenic
1031093848 7:117394924-117394946 CTTTTATTGTTCAGGAATAAAGG + Intronic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1032443085 7:131957273-131957295 AATCTATTTTTGAGGAAAAAAGG + Intergenic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1033304756 7:140216751-140216773 TCTCTATGATTCAGAAAAAAAGG + Intergenic
1033906249 7:146207764-146207786 CATCTATTATTTAGAACAAAGGG - Intronic
1034225912 7:149481484-149481506 TTTGAAATATTCAGGAAAAAAGG - Intronic
1035191063 7:157169034-157169056 CTTTTATTGTTTAGGAAGAAAGG + Exonic
1037041053 8:14234411-14234433 CATATATTTTTGAGGAAAAATGG + Intronic
1037559962 8:20064713-20064735 CTTCTATCATTCAGGAAATTGGG + Intergenic
1038088130 8:24222614-24222636 CTTCTATTAAATAGGAGAAAAGG - Intergenic
1038998888 8:32957526-32957548 GTTCTGTTATTAAGGAAAAGGGG - Intergenic
1039105250 8:33982887-33982909 CTTCTAACATTTAGGGAAAAAGG - Intergenic
1039913951 8:41845969-41845991 CTTCTATTTTGCAGAGAAAATGG - Intronic
1040464199 8:47679252-47679274 CTCATATTATTCATCAAAAAAGG - Intronic
1040770772 8:50972535-50972557 GTTCTATGATTTAGGAAAAGAGG + Intergenic
1040801162 8:51342448-51342470 CTTAAATTAATCAGGAAAAATGG + Intronic
1041849691 8:62376751-62376773 ACTCTATTATTTAGGTAAAAGGG + Intronic
1042692607 8:71518932-71518954 ATAGTATTATTTAGGAAAAAAGG - Intronic
1042810068 8:72815181-72815203 CTTTTAATATTAAGGAAGAAAGG + Intronic
1042817174 8:72890410-72890432 CCTCTATTACTGAGGAACAAGGG - Intronic
1042959418 8:74287462-74287484 CTTGTAATGTTAAGGAAAAAAGG + Intronic
1042983185 8:74553403-74553425 TTTCAATTACTCAGAAAAAATGG + Intergenic
1043219493 8:77641466-77641488 CTTCTTTCATTCAGGACATATGG - Intergenic
1043356330 8:79416981-79417003 CTTCTTTTTTTCTGGAAACAAGG - Intergenic
1044017517 8:87062365-87062387 CTTACATTATTAAGAAAAAATGG + Intronic
1045315075 8:101036841-101036863 CTTCTATCATTGTAGAAAAAGGG - Intergenic
1045372026 8:101533948-101533970 CTTCTATTCTAAAGGAAAAGGGG + Intronic
1045471869 8:102519906-102519928 CTTCTATTATTTAAGAAACTGGG + Intergenic
1047029389 8:120860569-120860591 GTTCTCTTACTAAGGAAAAAGGG + Intergenic
1048482649 8:134814112-134814134 CTACTATAATTAGGGAAAAATGG - Intergenic
1051071569 9:13174427-13174449 TATCAATTATTCAAGAAAAATGG + Intronic
1051197015 9:14573163-14573185 CTTCTTATATTCAGCAAACATGG - Intergenic
1051403771 9:16711703-16711725 ATTCTATTATTCTGGAGAGAAGG + Intronic
1051586708 9:18734326-18734348 TGTCTTTTCTTCAGGAAAAAAGG - Intronic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1053348069 9:37392684-37392706 CTTCTATGAGTTAGGAAAGATGG - Intergenic
1055289592 9:74769020-74769042 TATCTATTATTAAGTAAAAATGG - Intronic
1056046970 9:82728780-82728802 CTTCTAATCTTCAGAAACAATGG + Intergenic
1056273751 9:84972371-84972393 CTTCTATTATGCTGCAGAAAGGG + Intronic
1057407606 9:94787828-94787850 CTTCTAAAAAGCAGGAAAAATGG - Intronic
1057904427 9:98973380-98973402 CTTCTGTAATTCAGAAAAATAGG + Intronic
1058186260 9:101859293-101859315 CCATTATTATTCAGAAAAAAAGG + Intergenic
1058190150 9:101904542-101904564 CTTTTATTATCCAGGATCAAAGG - Intergenic
1058336187 9:103832386-103832408 ATACTAGTGTTCAGGAAAAAAGG + Intergenic
1058774186 9:108267728-108267750 GTTCTATTATCTAGGACAAAAGG + Intergenic
1058965725 9:110036662-110036684 CTCATCTTATTCAGGAAAATAGG + Intronic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1060500817 9:124152809-124152831 CTTCTATTACTAAGGAAGAAAGG + Intergenic
1186790542 X:12993462-12993484 CTTCTATTTTTAAGGAGAAGTGG - Intergenic
1186893294 X:13981204-13981226 CTTCTGTTACTCATGAAGAAGGG + Intergenic
1187161008 X:16765297-16765319 CTTTATTTATTCAGAAAAAAAGG - Exonic
1187368394 X:18683388-18683410 CTTGTCTTATTGAGGAAAAGAGG - Intronic
1187955153 X:24510401-24510423 CTTTTATTATTTTGGGAAAATGG - Intronic
1188275826 X:28199217-28199239 CTCATATTAGTCAGGAGAAAGGG + Intergenic
1188895671 X:35665564-35665586 CTTCTATTATTGAGGGGAACTGG - Intergenic
1189604986 X:42667579-42667601 TTTCCATTATTTAGAAAAAATGG + Intergenic
1190928042 X:54926184-54926206 GGTCTATTATTCAGTAAAATGGG - Intronic
1191750948 X:64542132-64542154 CTTCTAGAATACAGGAAAAGAGG + Intergenic
1191807995 X:65155884-65155906 CTTCTAGAATACAGGAAAAGTGG - Intergenic
1194269157 X:91788697-91788719 CTACGATTACTCAGGAAAGAAGG - Intronic
1194557686 X:95381750-95381772 ATTCTCTTATTCTGGATAAAGGG + Intergenic
1194717136 X:97299973-97299995 CTTCTATTATTCTAAAAGAAAGG - Intronic
1194786443 X:98090130-98090152 CTCCAATTATTGAGGAAACAAGG + Intergenic
1195437648 X:104863974-104863996 CTTATACTATTCATGAACAATGG - Intronic
1196532591 X:116806400-116806422 CTTCTCTTAAGCAGAAAAAAAGG + Intergenic
1196568256 X:117233841-117233863 CTTCTTCTATTTAGAAAAAAAGG - Intergenic
1197976780 X:132174052-132174074 GTTTTATTATTAAGGAATAAGGG + Intergenic
1198329782 X:135611594-135611616 CTTCTACCATTCATGAAAATAGG - Intergenic
1198426283 X:136523857-136523879 CTTCTATGAATCATTAAAAAAGG - Intergenic
1198786623 X:140295857-140295879 ATTCTAGTATTCAGCAAAGATGG + Intergenic
1199064296 X:143396233-143396255 CTTTTAATGTTCAGAAAAAAAGG - Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic
1200304614 X:155011828-155011850 CCTCTATCATTCTGCAAAAATGG + Intronic
1200586372 Y:5009702-5009724 CTACGATTACTCAGGAAAGAAGG - Intronic
1200738765 Y:6830559-6830581 CTTCTATTTTTCTAGAAAAAGGG + Intergenic