ID: 1003389673

View in Genome Browser
Species Human (GRCh38)
Location 6:5702893-5702915
Sequence GTGAACACAGTGACATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003389673_1003389683 17 Left 1003389673 6:5702893-5702915 CCCTGGGATGTCACTGTGTTCAC 0: 1
1: 1
2: 1
3: 19
4: 205
Right 1003389683 6:5702933-5702955 AATTTCATATGAAGGGACTTTGG No data
1003389673_1003389684 20 Left 1003389673 6:5702893-5702915 CCCTGGGATGTCACTGTGTTCAC 0: 1
1: 1
2: 1
3: 19
4: 205
Right 1003389684 6:5702936-5702958 TTCATATGAAGGGACTTTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 164
1003389673_1003389681 10 Left 1003389673 6:5702893-5702915 CCCTGGGATGTCACTGTGTTCAC 0: 1
1: 1
2: 1
3: 19
4: 205
Right 1003389681 6:5702926-5702948 ACCAAGAAATTTCATATGAAGGG 0: 1
1: 2
2: 2
3: 22
4: 401
1003389673_1003389680 9 Left 1003389673 6:5702893-5702915 CCCTGGGATGTCACTGTGTTCAC 0: 1
1: 1
2: 1
3: 19
4: 205
Right 1003389680 6:5702925-5702947 CACCAAGAAATTTCATATGAAGG 0: 1
1: 1
2: 3
3: 17
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003389673 Original CRISPR GTGAACACAGTGACATCCCA GGG (reversed) Intronic
900075328 1:811536-811558 GTGAACCTAAAGACATCCCATGG + Intergenic
900383698 1:2399248-2399270 GGAAATACAGTGAAATCCCATGG - Intronic
902718012 1:18285931-18285953 GTGAACACACAGAGAGCCCAGGG - Intronic
903033865 1:20481908-20481930 ATGAACACAGTGCCAGCACATGG - Intergenic
905479454 1:38251095-38251117 GTGAGCGCAGTGACAACCCTGGG + Intergenic
905630066 1:39513669-39513691 GTGATCTCAGTAACATCCCAGGG - Intronic
905667693 1:39772521-39772543 GTGATCTCAGTAACATCCCAGGG + Intronic
906777008 1:48538954-48538976 ATGAGAACAGTGACATCACATGG - Intronic
907517295 1:55000656-55000678 CTGAACAGAATGACAGCCCAGGG - Intronic
907619230 1:55959385-55959407 GTCAACACTGTGACCTCCCTAGG - Intergenic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
910598605 1:89005999-89006021 GGGGACACAGTGAGCTCCCAGGG + Intergenic
916716054 1:167447663-167447685 GTAATCACAGCGACCTCCCAGGG + Intronic
918614762 1:186531803-186531825 GTGAACAGAGCTCCATCCCAGGG - Intergenic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922271168 1:224036413-224036435 GTGAACCTAAAGACATCCCATGG + Intergenic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
923287583 1:232511630-232511652 GTGGACAGAGTGACCTCCTAAGG + Intronic
1063071086 10:2664927-2664949 GTGATGACAGTGAGATCACATGG + Intergenic
1063602685 10:7496731-7496753 GTGATCAAAGTGGCATACCATGG - Intergenic
1064388383 10:14920181-14920203 ATGAATACAGTGACATCCTCTGG + Intronic
1065764621 10:29016260-29016282 GAGAACAAAATGACACCCCAAGG - Intergenic
1066003624 10:31127635-31127657 GTGAACACAGTGCCATATAAAGG + Intergenic
1066220095 10:33328682-33328704 CTGGGCACAGTGACATCACATGG + Intronic
1067017236 10:42767363-42767385 ATGAACACAAAGACATTCCAAGG + Intergenic
1067222889 10:44356759-44356781 CTGAGCCCAGTGACTTCCCAGGG - Intergenic
1067815223 10:49469659-49469681 GTGAACACAGTGACTGCTAAGGG + Intronic
1069567096 10:69470908-69470930 GAAAACACAGGCACATCCCAAGG + Intronic
1070765358 10:79053243-79053265 ATGGACACTGTGACAGCCCAGGG - Intergenic
1071398889 10:85250135-85250157 GTGAACACAGCGTCCTCACATGG + Intergenic
1071699561 10:87915614-87915636 GAGAGCACAGTGGCCTCCCAGGG + Intronic
1071851710 10:89578861-89578883 GTGAACACGGTGGTTTCCCAAGG - Intergenic
1071895147 10:90058233-90058255 TTTTACACAGTGACATACCATGG - Intergenic
1073543762 10:104332674-104332696 TTGTAAACAGTGCCATCCCAGGG + Intronic
1074541727 10:114370794-114370816 ATGAACCCAGTGACCTCCAATGG - Intronic
1074734732 10:116418200-116418222 GTGAACAGAATAAAATCCCATGG + Intergenic
1074920319 10:118001987-118002009 GTGCTCACAGTGTCATCCCCAGG - Intergenic
1075015914 10:118909916-118909938 GTGAGCCCAGTGTAATCCCAGGG + Intergenic
1076390528 10:130097904-130097926 GTGAACAGAGTGACTACCAATGG + Intergenic
1077753364 11:4999198-4999220 GTGTAGACAGGGACATCCCCAGG - Exonic
1080403882 11:31961415-31961437 GTGAACTCAGTGTAATCACAAGG - Intronic
1083613351 11:64014792-64014814 GCAGACACAGAGACATCCCAGGG + Intronic
1084609206 11:70191492-70191514 ATGAAAACATTGACAACCCAAGG - Intergenic
1084714154 11:70863119-70863141 GTGAACACTGTCACATTCCAGGG + Intronic
1086676088 11:89608664-89608686 CTGGACACACAGACATCCCAGGG - Intergenic
1088129379 11:106468674-106468696 GGGAACCCAGTGGCATCCTAGGG + Intergenic
1089226097 11:116923751-116923773 GTTAACACAGAGAGAGCCCAAGG + Intronic
1092271875 12:7030253-7030275 GTGGGCAAAGTGACACCCCAAGG - Intronic
1094539204 12:31349007-31349029 GTCAACAGAGTGAGACCCCATGG - Intergenic
1102242825 12:111335941-111335963 GTGCCCACGGTGAGATCCCAGGG + Intronic
1102452458 12:113052179-113052201 GTGAGCACAGATTCATCCCAGGG - Intergenic
1102525275 12:113508169-113508191 GTGAGCCCAGTGTCATCACAAGG + Intergenic
1102769043 12:115457402-115457424 GTGAGCAGAGCCACATCCCAAGG - Intergenic
1102975061 12:117200909-117200931 GTGGATCCAGTGTCATCCCAAGG + Intergenic
1105532593 13:21233227-21233249 GGGAACACAGTGACATCCCAGGG + Intergenic
1106682296 13:32020410-32020432 GTGTACACAGTGAAATTACAGGG + Intergenic
1107675635 13:42793905-42793927 GTGAAGTGAGTGACATGCCAGGG + Intergenic
1109048024 13:57438128-57438150 GGGAACCCAGTGAGCTCCCAGGG + Intergenic
1110989692 13:82024196-82024218 TAGAACACATTTACATCCCAGGG + Intergenic
1111712776 13:91838267-91838289 CAGAACTCAGTGACATCCCCAGG + Intronic
1113015932 13:105828294-105828316 GCTAACACAGTGAAATCCCGGGG - Intergenic
1120134550 14:80850664-80850686 GTGAATAAAGTGACATTTCATGG - Intronic
1120627231 14:86843313-86843335 GTAAACACAGTGAAAACCCCTGG - Intergenic
1121102672 14:91260903-91260925 GTGGACCCAGTGTCATCACAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122363349 14:101180361-101180383 GTGAGCCCAGTGAGATCGCAGGG + Intergenic
1122509624 14:102255938-102255960 GTGAACACAGTGATAAACCAAGG + Intronic
1123449789 15:20352428-20352450 GTGAACCCAGTGGCATGACAAGG - Intergenic
1124594099 15:31079564-31079586 GTGTCCAAAGTGACAGCCCATGG + Intronic
1124619765 15:31267007-31267029 GTGAATACAGTGATGTGCCAAGG + Intergenic
1124987563 15:34636594-34636616 CAGAACTCAGTGACATCCCCAGG + Intergenic
1128460644 15:67864010-67864032 GGGAACACTGTGACGTTCCAAGG - Intergenic
1128498912 15:68213820-68213842 GTGCTCCCAGTGACATCTCAGGG + Intronic
1130140532 15:81222304-81222326 TGGAAAACAGTGACATCCAAGGG - Intronic
1130191464 15:81740181-81740203 GTGAACACATTAATCTCCCAAGG - Intergenic
1131633111 15:94200833-94200855 GTTAACACAGTGAAATCCAGAGG + Intergenic
1133929671 16:10222043-10222065 GTGACCACAGGCACATGCCATGG + Intergenic
1134334095 16:13278996-13279018 GTGCACAAAGTGACATTCTAAGG - Intergenic
1134653782 16:15931032-15931054 GTGAACACAGTGAGAAAACATGG - Intergenic
1135925088 16:26686969-26686991 GTGGACCCAGTGTCATCACAAGG - Intergenic
1137612866 16:49830544-49830566 GTCAACACAGTGAGATACAAGGG + Intronic
1138209246 16:55149292-55149314 GGGGACACATTGACATCCCAGGG - Intergenic
1138585302 16:57965896-57965918 GTGCACACACAGACATACCAAGG + Intronic
1141267727 16:82512076-82512098 GTCATCACAGGGACATCACATGG + Intergenic
1144114915 17:12078566-12078588 CTGAAGAAAGTGATATCCCAAGG + Intronic
1149039459 17:52170797-52170819 TGGAACACAGTTACATACCATGG - Intergenic
1150644194 17:66968066-66968088 GTGAAGACAGCGTCCTCCCAGGG - Intronic
1151875473 17:76865731-76865753 GTGAACACAGGGGCATCACAGGG + Intergenic
1152113416 17:78369954-78369976 GGGAACCCAGTGATGTCCCAGGG - Intergenic
1153586318 18:6624295-6624317 GTGCCCACAGTGACAACACAGGG + Intergenic
1156874743 18:41995500-41995522 GATAATACAGTGACATCACAAGG + Intronic
1157783187 18:50458213-50458235 GTGAGCATAGTGACTTCACATGG - Intergenic
1160325655 18:77945136-77945158 GTGGACCCAGTGTCATCACAGGG - Intergenic
1161763455 19:6191582-6191604 TTGAACACAGTGACACCCAGAGG - Intronic
1162085113 19:8244032-8244054 GTGAACCCAGTGTCATCACAAGG + Intronic
1163214072 19:15863199-15863221 GGGAACACAGAGAAACCCCAGGG - Intergenic
1163746642 19:19052647-19052669 GTCAGCACTGTGACCTCCCAGGG - Intronic
1164278962 19:23751522-23751544 GTGAACACAGTCACATATTACGG - Intronic
1164472395 19:28547083-28547105 GTGAGGATAGTGACATCACATGG + Intergenic
1165422888 19:35731210-35731232 CTGAACACAGTAACATGCTAGGG + Intronic
1166159137 19:40938575-40938597 GTGAATACAGCTAAATCCCAGGG - Intergenic
1166168084 19:41006511-41006533 GTGAGTACAGTTAAATCCCAGGG - Intronic
1166250807 19:41569743-41569765 AGGTCCACAGTGACATCCCAGGG + Intronic
1166891560 19:45997119-45997141 GCGAACACATTGCCATCTCAGGG + Intronic
1167686279 19:50958782-50958804 GTGAAGAAAGGTACATCCCAAGG + Exonic
1167848900 19:52187153-52187175 GGCAACACAGTGAGACCCCAGGG + Intergenic
929310415 2:40417745-40417767 GTGGACACTGTGCCATCCAAAGG - Intronic
932315477 2:70779077-70779099 GAGAGCACAGTAAAATCCCAGGG + Intronic
932559566 2:72855275-72855297 ATGAGCAGAGTGAGATCCCAAGG - Intergenic
936411571 2:112262751-112262773 GGCAACACAGTGAGACCCCATGG - Intergenic
937521691 2:122720478-122720500 GGGAACCCAGTGAGCTCCCAGGG - Intergenic
937744708 2:125397994-125398016 CTGAACAAAGTGACCTCTCAGGG + Intergenic
938974645 2:136464344-136464366 GTGAACACAATTGCATTCCAGGG - Intergenic
942215631 2:173716723-173716745 GAAAACACAGTGACATCTAATGG + Intergenic
943641917 2:190368975-190368997 TTCAATACAGTGACATCCAAAGG + Intronic
944862748 2:203830335-203830357 GTGAACTCAGTAACCTCTCAAGG + Intergenic
945195961 2:207237934-207237956 GTGAACACAGTGACAGACACTGG + Intergenic
945400481 2:209376135-209376157 GAGAGCACTGTGACATACCAAGG + Intergenic
947070426 2:226282097-226282119 GTGCACACAGAGAGATACCAGGG + Intergenic
949082394 2:242113259-242113281 GTGAACCTAAAGACATCCCATGG - Intergenic
1169791663 20:9416247-9416269 GGGATCACAATGACATCTCAGGG - Intronic
1174031025 20:47626745-47626767 GAGAACACAGTGACAAGCCAAGG - Intronic
1179197200 21:39175683-39175705 GTGAATACAGTGAGACCCCAGGG + Intronic
1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG + Intergenic
1179820413 21:43933957-43933979 GTCCACACAGTGACAGCACATGG - Intronic
1181167429 22:20991276-20991298 GTGAACACAGTGACCTGCAATGG + Intronic
1181411295 22:22721628-22721650 GTGAGCACTGTGGCATCCCTTGG + Intergenic
1181439802 22:22929938-22929960 GTCAACACAGTGACATCAGCAGG + Intergenic
1181961053 22:26622067-26622089 GATGACACAGTGACATCCCTAGG - Intronic
949508129 3:4745535-4745557 GTAAACACAGGGACTTCTCAGGG + Intronic
954199021 3:49013248-49013270 GTGACCTCAGTCACATGCCATGG + Exonic
955461715 3:59190150-59190172 GGGGACACAGTGAGCTCCCAGGG + Intergenic
955942443 3:64159150-64159172 TTGAACGCAGTGAGGTCCCAGGG + Intronic
957327160 3:78711237-78711259 GAGAGCACAGGGACATCCTAGGG - Intronic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
959351821 3:105274901-105274923 GTGCACAAAGTGAAATTCCATGG + Intergenic
959436430 3:106320242-106320264 GTGCACAAACTGACATCCTAAGG + Intergenic
959783868 3:110269304-110269326 GAGAGCACAGTGATTTCCCAAGG - Intergenic
960763483 3:121098435-121098457 GTGAAGACAGTACCATGCCATGG + Intronic
961958752 3:130831935-130831957 GTGAGCACAGCGATATCCCCTGG - Intergenic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
963342589 3:144054975-144054997 ATGAACTCAGCCACATCCCAGGG - Intergenic
967063241 3:185891215-185891237 GTGGACATAGTGACATCCACTGG - Intergenic
975516254 4:75251555-75251577 GTGGCCACAATGACATCCAAAGG - Intergenic
977170575 4:93756968-93756990 GTGAAAACAGAGACGTCTCAAGG + Intronic
977439633 4:97047502-97047524 GAGAACAGAGTGAGAACCCATGG + Intergenic
977598046 4:98905437-98905459 ATGAACACAGCACCATCCCATGG - Intronic
977852574 4:101848008-101848030 GGGAACCCAGTGAGCTCCCAGGG + Intronic
978256140 4:106694784-106694806 GAGAAAACAGTTACATCACAAGG - Intergenic
978873443 4:113608105-113608127 GTTATCACAGTGACTTCCAAAGG - Intronic
981008863 4:139903924-139903946 GGGAACACTGTGTCCTCCCATGG + Intronic
982788748 4:159566086-159566108 GTGAACACAGTGGCTTCCCATGG - Intergenic
983198179 4:164831505-164831527 GACAACACAGTCACATCCCATGG + Intergenic
985180770 4:187259113-187259135 TTGAAAACTGTGACCTCCCAAGG + Intergenic
989116452 5:37958520-37958542 GTGAACCCAGTGTAATCACAAGG - Intergenic
990416368 5:55590964-55590986 GTGAAGGCAGTGCCAGCCCAAGG + Intergenic
991426230 5:66494866-66494888 GAGAACACAGTGAGGACCCAGGG + Intergenic
994953671 5:106498762-106498784 GTGAGCCCAGTGTGATCCCAGGG - Intergenic
996124245 5:119706595-119706617 GGGAACCCAGTGAGCTCCCAGGG + Intergenic
996483764 5:124006103-124006125 GTGAAAACAGTGACTTTTCAGGG - Intergenic
996516715 5:124378273-124378295 GGCAACAGAGTGACATCCTAGGG - Intergenic
997298710 5:132786343-132786365 GTGGGCCCAGTGAAATCCCAAGG + Intronic
997574736 5:134965978-134966000 TTGAGCACAGTGACATATCAGGG + Exonic
997675825 5:135712535-135712557 GTGAACACAGTCAGGTCTCAGGG - Intergenic
997749015 5:136326818-136326840 GTGATCACAGTGACAGATCATGG + Intronic
998618740 5:143771290-143771312 GTGGAGACAGTCACATTCCAAGG + Intergenic
1002043878 5:176531575-176531597 GTCACCACAGTGACGACCCAAGG - Exonic
1002813747 6:659701-659723 GGGGACACAGTGAGCTCCCAGGG - Intronic
1003389673 6:5702893-5702915 GTGAACACAGTGACATCCCAGGG - Intronic
1005643754 6:27821867-27821889 GTGAACACATAGATATCCTAGGG - Intergenic
1006227152 6:32548503-32548525 GTGAACTGAGTGAGAACCCATGG - Intergenic
1007673572 6:43576457-43576479 CTGAACACAGTGACAGCGAACGG - Intronic
1008980863 6:57482441-57482463 GTCAGCACAGTGACATCCTATGG + Intronic
1009798426 6:68502437-68502459 GGGGACACAGTGAGCTCCCAAGG - Intergenic
1011138674 6:84128881-84128903 GAGAACACAGTGACATAGGAGGG - Intronic
1015906424 6:138122044-138122066 GTGTAATCACTGACATCCCAGGG + Intergenic
1016166929 6:140957579-140957601 GTGAAGGAAGTGACATCACATGG - Intergenic
1016931036 6:149409688-149409710 GTGAACAGTGTGAGATGCCAAGG + Exonic
1018160130 6:161032327-161032349 CTGAGCACAGTGACCTCCCAAGG + Intronic
1019904520 7:4051662-4051684 GTGACCACAGTGACAGCCTCGGG - Exonic
1020074120 7:5246531-5246553 TTGAACACAGTCATTTCCCAGGG + Intergenic
1021533995 7:21681943-21681965 ATGAACACAGTGATTTCTCACGG - Intronic
1021689385 7:23217407-23217429 TGGACCACAGTGACTTCCCAGGG + Intergenic
1023171357 7:37392873-37392895 GGGAGCACAGTTACCTCCCAGGG - Intronic
1024155000 7:46613130-46613152 GTGAACACAGAAACCTGCCATGG + Intergenic
1024567033 7:50689639-50689661 GTGCACACAGTGTCTACCCATGG + Intronic
1024902932 7:54342877-54342899 GTGAACACAGAAATACCCCATGG + Intergenic
1025204973 7:56987279-56987301 TTGAACACAGTCATTTCCCAGGG - Intergenic
1025666965 7:63589656-63589678 TTGAACACAGTCATTTCCCAGGG + Intergenic
1028624951 7:92867444-92867466 GTGCTCACAGTGATATCCCAAGG - Intergenic
1031920079 7:127593868-127593890 GTGGATACACAGACATCCCAAGG + Exonic
1031982488 7:128136646-128136668 GTGATGACAGTGACAACCCCAGG + Intergenic
1034390955 7:150787381-150787403 GTCAGCACTGTGCCATCCCATGG + Intergenic
1035011042 7:155715035-155715057 GGGAACACAGGGACATGCGATGG - Intronic
1035658140 8:1326877-1326899 GTAAACACAGTGACAATACAGGG + Intergenic
1037748060 8:21662288-21662310 ATGGGCACAGTGACATCTCAGGG + Intergenic
1038236988 8:25769043-25769065 GGGGACACAGTGAGCTCCCAGGG - Intergenic
1042490407 8:69391350-69391372 GTGAACATAGTGACCTACGAAGG - Intergenic
1043162025 8:76857538-76857560 GTGAAAACAATGACATCCTATGG + Intronic
1043232357 8:77819110-77819132 GGGAACACAGTGACATATAAAGG - Intergenic
1043736095 8:83745880-83745902 GTTAAGAAAGTGGCATCCCAGGG + Intergenic
1046353092 8:113041392-113041414 GGCAGCACAATGACATCCCAAGG - Intronic
1049266191 8:141669061-141669083 GTGGATTCAGTGACATCCTATGG - Intergenic
1050463075 9:5893763-5893785 GGGACAAAAGTGACATCCCAAGG - Intronic
1052042058 9:23749992-23750014 ATGAACACAGTGGCCTCCAAGGG + Intronic
1052128059 9:24803467-24803489 GTGAATGCAGTGAGATCCCAAGG - Intergenic
1053651396 9:40173533-40173555 TTGAACACAGTGATTCCCCAAGG - Intergenic
1053901790 9:42802886-42802908 TTGAACACAGTGATTCCCCAAGG - Intergenic
1054533184 9:66202670-66202692 TTGAACACAGTGATTCCCCAAGG + Intergenic
1055686402 9:78779690-78779712 GTGAAGACAGAGACATAGCAGGG - Intergenic
1057423540 9:94930511-94930533 TTGAACACAGTGAAATCCTCAGG + Intronic
1058606664 9:106730533-106730555 GGGAACAAAGTGAAATCTCAAGG - Intergenic
1058623294 9:106906042-106906064 GGGGACCCAGTGAGATCCCAGGG + Intronic
1059150426 9:111944656-111944678 ATCAACAGAGTGACATCCTAGGG - Intergenic
1059621133 9:116006820-116006842 ATGAAGAGAGGGACATCCCAGGG + Intergenic
1059789807 9:117628889-117628911 GGGAACACACTTAGATCCCAGGG - Intergenic
1060271278 9:122143846-122143868 GTGAACACAGACACACCCCAAGG + Intergenic
1060780860 9:126411485-126411507 GTGAACACAGGCCCATGCCAGGG - Intronic
1060929265 9:127478707-127478729 ATGCACACAGTGACAGCCCAGGG + Intronic
1061594182 9:131618319-131618341 CTGAACTCACTGACATCCCTGGG - Intronic
1062075042 9:134583280-134583302 GTGTACGCAGTGACTTCCGATGG - Intergenic
1186365788 X:8891964-8891986 GTGAGCCCAGTGTCATCACAGGG + Intergenic
1187855854 X:23635906-23635928 GTGGTCATACTGACATCCCACGG - Intergenic
1192227038 X:69236655-69236677 CTGAACACAGCTACTTCCCATGG - Intergenic
1195531975 X:105968071-105968093 ATGAACACTGTGACCTCACATGG + Intergenic
1195698391 X:107683655-107683677 GGGAACAGAGTGACCTGCCAAGG + Intergenic
1198613403 X:138426639-138426661 GTAAAAACATTGTCATCCCAAGG + Intergenic