ID: 1003390227

View in Genome Browser
Species Human (GRCh38)
Location 6:5707323-5707345
Sequence CTGAGAATAAAGTGGTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003390220_1003390227 25 Left 1003390220 6:5707275-5707297 CCAACCATTATTCCAATATTACA 0: 1
1: 1
2: 2
3: 23
4: 240
Right 1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 175
1003390222_1003390227 21 Left 1003390222 6:5707279-5707301 CCATTATTCCAATATTACATGGA 0: 2
1: 0
2: 0
3: 21
4: 254
Right 1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 175
1003390223_1003390227 13 Left 1003390223 6:5707287-5707309 CCAATATTACATGGATTTGAAAA 0: 2
1: 0
2: 1
3: 37
4: 398
Right 1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003390227 Original CRISPR CTGAGAATAAAGTGGTACCA GGG Intronic
903271742 1:22193027-22193049 CTGACAATAAAGTGTTGGCAAGG - Intergenic
904915058 1:33964139-33964161 TTGAGATTGAAGTGGTGCCATGG + Intronic
905514588 1:38552922-38552944 CTGAGATCAAGGTGGCACCATGG + Intergenic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
906975586 1:50568763-50568785 CTGATACTACAGTGGTAGCAGGG + Intronic
907291950 1:53420633-53420655 CTGAAAGTACATTGGTACCAGGG - Intergenic
907769732 1:57448953-57448975 CAGAGAAGAAAGTGTGACCATGG - Intronic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
909497158 1:76291129-76291151 TTGAAAATAAAGTGGTTCCTGGG + Intronic
909845863 1:80394005-80394027 CAGAAAATAAAATGGTGCCATGG + Intergenic
910013218 1:82490906-82490928 TTGAAAAAAAAGTGGAACCAGGG + Intergenic
910346222 1:86241831-86241853 CTGAAAATCAAGGGGAACCACGG + Intergenic
915219425 1:154362480-154362502 CTGAGGACAAGGTGGTCCCAAGG - Intergenic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
918591950 1:186249908-186249930 CTGAGAAAAAAGTGGTTTCATGG - Intergenic
918652931 1:186988093-186988115 TTGGGAATAAAGTGGTAGCATGG - Intronic
919176575 1:194026860-194026882 CTGGGAAGTAAGTGGTAGCAAGG - Intergenic
920258619 1:204673949-204673971 CTGAGAACAAAAGGGTACCTGGG - Intronic
921445938 1:215247785-215247807 CTGAGATTAAGGTGTTAGCAGGG + Intergenic
922176901 1:223203911-223203933 CTGATAATAAAGTGATAATAAGG - Intergenic
1063018984 10:2107206-2107228 CTTAGAATAAACTGGTTCAAGGG - Intergenic
1063641580 10:7835914-7835936 CTGGGAAGAAAGTGGTAGCTGGG - Intronic
1064313791 10:14236181-14236203 CTGAGAATGAAATGGGACTAAGG - Intronic
1064980205 10:21158902-21158924 CTAAGAAAAAAGTGGAACCCTGG - Intronic
1065950225 10:30644752-30644774 CAGATAATAAGGTGGTACAATGG + Intergenic
1065973898 10:30826024-30826046 CTGAGATTAAAGTGGCAGAACGG - Intronic
1066481184 10:35796933-35796955 CTGAGAATAAAGCGGCTTCACGG + Intergenic
1067541591 10:47158939-47158961 CTCAGAAGAGAGTGGCACCATGG + Intergenic
1067978496 10:51054394-51054416 CTGAAAATTAAATGTTACCAGGG + Intronic
1070473646 10:76810900-76810922 GTGAGAATCAAATGATACCATGG + Intergenic
1072042718 10:91624747-91624769 ATGAGAATAAAGTGAGATCATGG - Intergenic
1072430314 10:95365433-95365455 CTGAGAATAAAGAGGTGGCCTGG + Intronic
1079927922 11:26519555-26519577 CTGAGATCAAAGTGGCAGCATGG + Intronic
1081832167 11:46122397-46122419 CTGCTAATAAAGTGGTTCAAGGG - Intergenic
1082180305 11:49109076-49109098 GTGAGAAAAATGTGGTCCCAAGG + Intergenic
1082205335 11:49426751-49426773 CTGAGATCAAAGTGTCACCAGGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1086223225 11:84475467-84475489 AGGGGAATAAAGTGGTCCCAGGG + Intronic
1086649768 11:89273783-89273805 CTGAGATCAAAGTGTCACCAGGG + Intronic
1086685182 11:89725769-89725791 GTGAGAACAATGTGGTCCCAAGG - Intergenic
1087314242 11:96587585-96587607 CTAAGAATGAAGTAGAACCAAGG - Intergenic
1088141140 11:106617923-106617945 CTGATAATAATCTAGTACCATGG - Intergenic
1092747154 12:11684074-11684096 CTGAGAAAAAAGTGATTCAAGGG + Intronic
1094255174 12:28415809-28415831 CTAAGAATAAAGTGGAAAAAAGG + Intronic
1097484824 12:60183018-60183040 CAGTGCATAAAGTGATACCAGGG - Intergenic
1098572449 12:72003965-72003987 CAGAGAATAAAGAGTTACCAAGG - Intronic
1099590586 12:84583294-84583316 AAAAGAACAAAGTGGTACCAAGG - Intergenic
1108104964 13:46998793-46998815 CTGAGACTAAGGTGTTAACAGGG - Intergenic
1108782738 13:53856346-53856368 CTAATTATAAAGTGTTACCAGGG - Intergenic
1110353929 13:74543738-74543760 CTGAGAATACAGTGATATCATGG - Intergenic
1110868688 13:80424955-80424977 CTTAAAAAAAAATGGTACCAAGG - Intergenic
1113984120 13:114300295-114300317 CTGAGACTAAAGTGGTCCAGTGG - Intronic
1114554727 14:23555541-23555563 CAGAGAATAAAGTGGTATTTTGG - Intronic
1117215900 14:53551341-53551363 CTGAGAATAGAGAGATAACAAGG - Intergenic
1119023371 14:71133755-71133777 CTGAGATTGAAGTGGTACAGAGG - Intergenic
1119494360 14:75065926-75065948 CTTAGAGTAATGTAGTACCATGG + Intronic
1120751649 14:88203645-88203667 CTGAGAATCTAGTGTTACCGGGG + Intronic
1120900008 14:89567589-89567611 CTAGGTACAAAGTGGTACCAAGG + Intronic
1121045767 14:90786342-90786364 GTGAGAACAAAGTGGGAGCAAGG + Intronic
1122284582 14:100643121-100643143 CTGAGATTGAGGTGTTACCAGGG - Intergenic
1122522139 14:102352242-102352264 CTTAGAATCAGGTGGCACCAGGG - Intronic
1127456993 15:59164399-59164421 GAGAGAATAAAATGTTACCATGG - Intronic
1130303055 15:82694770-82694792 CTGAGATTAAAGTGTCAGCAGGG + Intronic
1131159603 15:90096504-90096526 CAGAAAATAAAGTGCTAGCAAGG + Intronic
1131617893 15:94035510-94035532 CTAAGAATAAAATGGTATGAGGG + Intergenic
1132712854 16:1277005-1277027 CTGAGGATAAAGGGGCTCCAAGG - Intergenic
1133425753 16:5687713-5687735 CTGAGAATGAAGGGGTTCCCAGG - Intergenic
1138785770 16:59844696-59844718 GTGAGAATACAGTGGCCCCAAGG - Intergenic
1139207789 16:65045893-65045915 CAGAGCATAAAATAGTACCAAGG + Intronic
1143417679 17:6761423-6761445 GTGAACATAAAATGGTACCAGGG - Intronic
1143866922 17:9930786-9930808 TTGAGAAGAAAGTGGCTCCAAGG - Intronic
1144108250 17:12006588-12006610 CTGAGCATAAATTATTACCAGGG + Intergenic
1145159220 17:20563195-20563217 CAGGAAATAAAGTGGGACCAGGG + Intergenic
1145790956 17:27626411-27626433 TTGTGAATAAAGTTATACCAAGG + Exonic
1146262565 17:31431647-31431669 GGGAGAATAAAGTGGCCCCATGG + Intronic
1147537307 17:41328947-41328969 CTGGGAAGAGAGGGGTACCAGGG + Intergenic
1148540660 17:48477887-48477909 ATGAGAATAAATTGGTGTCATGG + Intergenic
1149785676 17:59432782-59432804 CTGGGAATAAATAGGTGCCAAGG + Intergenic
1149975342 17:61260132-61260154 CTGTAAATAAAGTGGAAACAGGG - Intronic
1150972538 17:70044986-70045008 CTGAGAAGAAAAGGGAACCATGG - Intergenic
1153116370 18:1661573-1661595 CTCAGAATAAAGTGGTTTGATGG - Intergenic
1156778143 18:40818844-40818866 CTGTGAAGGAAGTGGTAACAAGG + Intergenic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1160229876 18:77039746-77039768 CTGTGAATCAAGTGGTAGGAAGG + Intronic
1167771180 19:51519914-51519936 CTGAGAACAAGGTGTTATCAGGG - Exonic
1168000018 19:53438188-53438210 CTGAGGATGACTTGGTACCAAGG - Intronic
1168435682 19:56315181-56315203 CTGGGAATAAGGCGGGACCAGGG + Intronic
927067279 2:19486115-19486137 CTGAGAAATCAGAGGTACCATGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930127591 2:47814827-47814849 CTGTTAATAAAGTAGTAGCAGGG - Intronic
930136471 2:47906958-47906980 CTGAAAAAAAAGTGGAACGAGGG + Intergenic
931176165 2:59857202-59857224 CTAAGAAAATAGTGGTACTATGG - Intergenic
933671071 2:85007669-85007691 CTGAGGACACAGTGGTACCTGGG - Intronic
934080134 2:88460571-88460593 CAGAGAGTAAAGTGCTATCATGG - Intergenic
934584087 2:95474340-95474362 CTGAGAGTAATATGGTATCATGG - Intergenic
934595365 2:95602374-95602396 CTGAGAGTAATATGGTATCATGG + Intergenic
934787406 2:97023160-97023182 CTGAGAGTAATATGGTATCATGG - Intergenic
935441118 2:103096908-103096930 CAGAGCAAAAAGTGTTACCAGGG + Intergenic
937249577 2:120515073-120515095 CTGGGAAGAAGGTGGTGCCAGGG - Intergenic
938614702 2:132985112-132985134 CTGTGAATAAAATGGTGCCCTGG - Intronic
939981975 2:148793485-148793507 CTGAAACCAAAGTGGTGCCAGGG + Intergenic
941823696 2:169868919-169868941 AGGGGAATAAAGGGGTACCAGGG - Intronic
942061095 2:172229364-172229386 GTGATAAGAAAGTGGCACCAAGG + Intergenic
943504514 2:188737141-188737163 GTCAGAATAAAGAGGTAACATGG + Intronic
943720374 2:191198002-191198024 CTGAGAAGAAAGTGGCTCCCTGG + Intergenic
944002915 2:194863263-194863285 CTTAGAACAGAGTGCTACCAGGG - Intergenic
945133044 2:206595446-206595468 CTGAGAAAAGAGGGTTACCAAGG + Intronic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
948276662 2:236714197-236714219 CTGAGATCAAAGTGGTGGCAGGG - Intergenic
1170080376 20:12468442-12468464 CAGAGAATAATGTTCTACCAAGG + Intergenic
1170495591 20:16921399-16921421 CTGAGGATACAGTGGTTCTATGG + Intergenic
1172823756 20:37762189-37762211 TTGAGAATAATATGGTAACATGG - Intronic
1172866356 20:38101958-38101980 CTGAGAACAGAGTGTTAGCATGG - Intronic
1173566613 20:44043366-44043388 CTGAGAACAGAGAGGTACAAAGG - Intronic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1175002187 20:55641494-55641516 CTGAGTATAAACTGGACCCAGGG + Intergenic
1177150864 21:17454349-17454371 CTGAAAATACAGTGGAATCAAGG - Intergenic
1180744338 22:18077464-18077486 CTGAGAATATGTTGGTCCCAAGG - Intergenic
949636703 3:5990342-5990364 ATGAGAATAAAGTGCCTCCAAGG - Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
953076539 3:39576476-39576498 CTGAGAATAAAGTCTTTCCAAGG - Intergenic
954164885 3:48748795-48748817 CTGATAATAAAGTAACACCATGG + Exonic
954607840 3:51927865-51927887 CTGACCACAAAGGGGTACCAAGG + Intergenic
955857871 3:63293621-63293643 CTGAGATTAAAGTGCCAGCAAGG + Intronic
956392693 3:68790690-68790712 CAGGGAACAAAGTGGTACAATGG + Intronic
956725554 3:72153729-72153751 CTTAAAATAAACAGGTACCAGGG - Intergenic
958703373 3:97621573-97621595 CTAAGAAGAAAGTTGAACCAGGG + Intronic
958862392 3:99460025-99460047 CTGAAAATAAAGTTGTTCAAAGG + Intergenic
961445356 3:126978103-126978125 GTGACAATAAAGTGGTGACACGG + Intergenic
965259264 3:166459339-166459361 CTGAGATCAGAGTGGTAACAGGG - Intergenic
971120337 4:23697321-23697343 ATGAGACTCAAGTGGTACAAAGG + Intergenic
972150860 4:36089004-36089026 CTGAGATTCAAGTAGTACCAAGG - Intronic
972319514 4:37960371-37960393 CTAAATATAAAGTGGGACCACGG + Intronic
974972854 4:68851764-68851786 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975018459 4:69455685-69455707 CTGAGAACAAAGTTGAAGCAGGG - Intergenic
975817137 4:78229950-78229972 CTTAGAATAGTGTGGTGCCAAGG - Intronic
976231138 4:82844393-82844415 CTGTGGATAAGGTGGTACCTGGG + Exonic
976942190 4:90716450-90716472 CCTAGAATAAAGTGGTATCATGG + Intronic
977106473 4:92891723-92891745 CTGAGAATAAATTGTTACATCGG + Intronic
977835879 4:101646029-101646051 CTGAGAATAAAGAAGTAAAAAGG + Intronic
978208044 4:106103885-106103907 CTGGGAATAACATGGAACCAGGG + Intronic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
981471577 4:145141407-145141429 CAGTGAATAAGGTGGTACAATGG + Exonic
983636707 4:169905242-169905264 CAGAAAATAAAGAGGTGCCATGG + Intergenic
986351752 5:6886686-6886708 TTGAGAAGAAAGTGGGACAAAGG + Intergenic
986680462 5:10228415-10228437 TTGATAATAAAATGGTACAACGG - Intronic
987586326 5:19861548-19861570 TTGAGAATAAAGAGGGACAAAGG + Intronic
988729842 5:33961194-33961216 CAGGGAATAAAGAGGTACCCAGG - Intronic
990667322 5:58087978-58088000 CTGAGAAACAAGTAGAACCAAGG - Intergenic
991100105 5:62782539-62782561 CTAAGAATAATGAGGTACAAAGG + Intergenic
992063992 5:73086778-73086800 ATGAGACTAGAGTGGTAGCATGG - Intronic
993012223 5:82496131-82496153 CTGAGAATAAACTGTTACCAAGG + Intergenic
993996628 5:94730769-94730791 CTGGGAATAGGGTGTTACCAAGG - Intronic
999371255 5:151056670-151056692 CTGGGAATCCACTGGTACCATGG - Intronic
1001931923 5:175679237-175679259 CTGAGAAGAGAGTGCTCCCAGGG + Intronic
1002330551 5:178437614-178437636 CTGAGAACTCAGTGGGACCAGGG - Intronic
1003390227 6:5707323-5707345 CTGAGAATAAAGTGGTACCAGGG + Intronic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1010496388 6:76537868-76537890 CTGAGAATCAAGTGGGACATGGG - Intergenic
1010931954 6:81814468-81814490 CTGAGATTAAAGTGTTCACAGGG + Intergenic
1011177086 6:84575665-84575687 CTGAGAATTAAGTGAGATCATGG - Intergenic
1012711992 6:102618257-102618279 CTGACAGTAAACTGATACCAGGG + Intergenic
1016059954 6:139619921-139619943 CTGAGAATCCAGTGAGACCAAGG - Intergenic
1018645025 6:165940389-165940411 CCGAGCATAAAGTAGTATCAAGG + Intronic
1023079911 7:36516760-36516782 CTAACAATTATGTGGTACCAAGG + Intronic
1032928280 7:136635113-136635135 CTAAAAATAATGTGGTACCCTGG + Intergenic
1036466588 8:9003228-9003250 CTGAGAAGAAAGGGGTGCCGAGG - Intronic
1037236491 8:16726192-16726214 TTTAGAATAAAGGGATACCATGG - Intergenic
1037638605 8:20722527-20722549 CTGAGAATGAAGTGGTAGGATGG + Intergenic
1045951239 8:107854030-107854052 CTGAGGATGAAGTAGAACCATGG + Intergenic
1048556909 8:135487511-135487533 AAGAGAATAAGGTGTTACCATGG + Intronic
1051015816 9:12474788-12474810 AGGAGAAAAAAGTGGTTCCATGG + Intergenic
1052156966 9:25204020-25204042 CTGAGAAAAATGTGCAACCATGG + Intergenic
1052481120 9:29027709-29027731 CTAAGAATGAAGTGGTACTGCGG - Intergenic
1055999185 9:82195614-82195636 CTGAGAGTAATGTGGTATCAAGG + Intergenic
1060142343 9:121221181-121221203 CGGACAATAAAGTGGCATCATGG - Intronic
1187834262 X:23415276-23415298 CTGAGGATAAAGTTGTCTCATGG - Intergenic
1188077329 X:25794281-25794303 CTGAGAACATAGTAGTACCTGGG + Intergenic
1188720202 X:33513576-33513598 ATGAAAAGAAAGTGCTACCAAGG + Intergenic
1191711190 X:64151604-64151626 CTGAGAATGTTGTGGTGCCAGGG - Intergenic
1192115739 X:68409120-68409142 CTGAGAATCAAGTGAGATCATGG - Intronic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1194130374 X:90074100-90074122 CTGACAAGAAAGAGGTATCAAGG + Intergenic
1195753457 X:108178926-108178948 CTGAGAAGACAGTGGCACCTGGG - Intronic
1197596898 X:128475306-128475328 CTCAGGCTAAAGTGATACCAAGG + Intergenic
1197792993 X:130273928-130273950 ATGAGTGTAAAGTAGTACCATGG + Intergenic
1199676367 X:150193332-150193354 CTGAGCATGAATTGGGACCATGG - Intergenic
1199810183 X:151341330-151341352 ATGAGTAAAAAGTGGTACCCAGG + Intergenic
1201860585 Y:18593348-18593370 CTGAGAATAATGCAGTACCAAGG - Intergenic
1201872738 Y:18727033-18727055 CTGAGAATAATGCAGTACCAAGG + Intergenic
1202165464 Y:21982674-21982696 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202225893 Y:22603698-22603720 CTGAGAATAACGCAGTACCAAGG - Intergenic
1202317220 Y:23591963-23591985 CTGAGAATAACGCAGTACCAAGG + Intergenic
1202553545 Y:26078095-26078117 CTGAGAATAACGCAGTACCAAGG - Intergenic