ID: 1003390979

View in Genome Browser
Species Human (GRCh38)
Location 6:5712501-5712523
Sequence TGAACAGCAGGTGAACAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003390979_1003390982 1 Left 1003390979 6:5712501-5712523 CCCTACTGTTCACCTGCTGTTCA 0: 1
1: 1
2: 0
3: 14
4: 220
Right 1003390982 6:5712525-5712547 TTTCCATCTCCTCAGCAACTCGG 0: 1
1: 1
2: 1
3: 26
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003390979 Original CRISPR TGAACAGCAGGTGAACAGTA GGG (reversed) Intronic