ID: 1003391775

View in Genome Browser
Species Human (GRCh38)
Location 6:5719544-5719566
Sequence TACCTGAGATTTCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003391775_1003391779 15 Left 1003391775 6:5719544-5719566 CCTTTCTTCAGAAATCTCAGGTA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1003391779 6:5719582-5719604 CACAACTCAATGCCCTCGTGAGG 0: 2
1: 0
2: 1
3: 7
4: 63
1003391775_1003391782 29 Left 1003391775 6:5719544-5719566 CCTTTCTTCAGAAATCTCAGGTA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1003391782 6:5719596-5719618 CTCGTGAGGCCTCAACTCTCTGG 0: 2
1: 0
2: 1
3: 6
4: 105
1003391775_1003391778 -8 Left 1003391775 6:5719544-5719566 CCTTTCTTCAGAAATCTCAGGTA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1003391778 6:5719559-5719581 CTCAGGTAAGGCAGTTGCGAGGG No data
1003391775_1003391783 30 Left 1003391775 6:5719544-5719566 CCTTTCTTCAGAAATCTCAGGTA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1003391783 6:5719597-5719619 TCGTGAGGCCTCAACTCTCTGGG No data
1003391775_1003391777 -9 Left 1003391775 6:5719544-5719566 CCTTTCTTCAGAAATCTCAGGTA 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1003391777 6:5719558-5719580 TCTCAGGTAAGGCAGTTGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003391775 Original CRISPR TACCTGAGATTTCTGAAGAA AGG (reversed) Intronic
901300140 1:8194166-8194188 CATCTGAGCTTTCTGAACAATGG - Intergenic
902294775 1:15459537-15459559 TCCCTGAGAATTTGGAAGAAGGG + Intronic
906092620 1:43195044-43195066 TACCAGAGATTTCTGAGGACAGG + Intronic
908501797 1:64751097-64751119 TACATGAGATTTCTTTGGAATGG - Intronic
909349900 1:74639129-74639151 GAACTGAGGTTTCTGAAAAAAGG + Intronic
911174330 1:94804044-94804066 TACCTCAGATTTATGATGCAAGG - Intergenic
913536877 1:119781436-119781458 TACATGGAATTTCTCAAGAAGGG + Intergenic
913562064 1:120031582-120031604 TACCTGAAATTTCTCAGGATTGG + Intronic
913636060 1:120762012-120762034 TACCTGAAATTTCTCAGGATTGG - Intergenic
914282647 1:146190970-146190992 TACCTGAAATTTCTCAGGATTGG + Intronic
914543677 1:148641686-148641708 TACCTGAAATTTCTCAGGATTGG + Intronic
914622944 1:149429323-149429345 TACCTGAAATTTCTCAGGATTGG - Intergenic
915899130 1:159833954-159833976 TGCCTGAGATTTCTACAAAATGG + Intronic
919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG + Intergenic
921912715 1:220568401-220568423 TGCCAGACATTCCTGAAGAATGG + Intronic
922874677 1:228931151-228931173 TACCTAACATTTGTAAAGAACGG - Intergenic
923683593 1:236139219-236139241 TAGCTGAGATCCCTGATGAAGGG + Intergenic
923684635 1:236145353-236145375 TAAATGAGATTTTTGGAGAAGGG + Intronic
1063930099 10:11019074-11019096 GAGCTGGGATTCCTGAAGAAAGG + Intronic
1064780554 10:18833312-18833334 TGCCTCAGATTTCTTAACAATGG + Intergenic
1065912159 10:30317586-30317608 TTGATGAGATTTCTGAAGAGTGG - Intronic
1066316793 10:34255370-34255392 TACCTAGGATTTTTAAAGAAGGG - Intronic
1068005216 10:51385346-51385368 AACCTGAGATCTCTAAATAATGG + Intronic
1070580539 10:77715839-77715861 TTCTAAAGATTTCTGAAGAATGG - Intergenic
1071715417 10:88090544-88090566 TACCTGAGTTTTCAGGAGACTGG - Intergenic
1071715539 10:88091723-88091745 TACCTGAGTTTTCAGGAGACTGG + Intergenic
1071746075 10:88420954-88420976 TGCCTGAGACTTCCCAAGAAGGG - Intronic
1071817822 10:89251206-89251228 AACCTCAGATTCCTGAAAAATGG - Intronic
1071968127 10:90873628-90873650 TAGTTGACATTTCTGTAGAACGG + Intronic
1074988748 10:118682808-118682830 TAGATGAGATTGCAGAAGAATGG - Exonic
1075225671 10:120626598-120626620 TAACAGATATTTCTGAATAATGG + Intergenic
1075509955 10:123064063-123064085 CACTTGAGATGTCTGTAGAAAGG + Intergenic
1076987987 11:253201-253223 TACCTGAGAGGGCTGGAGAAGGG - Intergenic
1078831427 11:14980828-14980850 TAACTGAGATTTTTGTAGAGTGG + Intronic
1085465642 11:76721642-76721664 TTCCTGAGTTTTCTGCAAAAAGG - Intergenic
1086648518 11:89256752-89256774 GAACTCAGATTTCTGAAGAGGGG + Intronic
1086774695 11:90815647-90815669 TATCTGAGATCTCATAAGAATGG + Intergenic
1086968911 11:93059232-93059254 TTCCTGAGATTTGTGAAGTTTGG + Intergenic
1087312642 11:96567666-96567688 TTTCTGAGCTTTCTGAAGAACGG + Intergenic
1088390615 11:109310627-109310649 TAACAAGGATTTCTGAAGAAGGG - Intergenic
1091808756 12:3377347-3377369 TACATGAGACTTCTGGAGAGAGG + Intergenic
1091848536 12:3676960-3676982 TGCCCCAGATTTCTGGAGAAGGG + Intronic
1092119325 12:6033216-6033238 CAGCTGAGATTTCTGAAAGAGGG + Intronic
1092306866 12:7310424-7310446 TAGCTGAGGTAGCTGAAGAATGG + Intronic
1092667852 12:10824990-10825012 TACCTGACTTTTCTGAAGCAAGG - Intronic
1092805064 12:12214436-12214458 TTTATGAGATATCTGAAGAATGG - Intronic
1093286424 12:17269334-17269356 TCCCTGAGAATTCTGAGGAAGGG + Intergenic
1093960123 12:25263474-25263496 CACTTATGATTTCTGAAGAAGGG - Intergenic
1094112603 12:26877576-26877598 TGCCTGTGATTTCTGAATAATGG + Intergenic
1094238633 12:28196751-28196773 TACCTCAGATTACTGAAAATAGG - Intronic
1094944707 12:35824464-35824486 AACCTGCTATTTCTGAAGGAAGG - Intergenic
1094970005 12:36233461-36233483 AACCTGCTATTTCTGAAGGAAGG - Intergenic
1095021498 12:37066588-37066610 AACCTGCTATTTCTGAAGGAAGG - Intergenic
1095585471 12:43844633-43844655 GAACTGGGAGTTCTGAAGAATGG + Exonic
1095740754 12:45604072-45604094 TCCCAGTGATTTCTAAAGAAAGG - Intergenic
1098978483 12:76929810-76929832 TACCTGGGATTTTTGAGAAAAGG + Intergenic
1101370645 12:104126490-104126512 TATTTGAGATTTTTGGAGAATGG - Intronic
1101626979 12:106453859-106453881 TACCCTAGATTTCTTAAGGAAGG + Intronic
1105530896 13:21219279-21219301 CGCCTGAGTTTTCTGAAAAAAGG + Intergenic
1106343088 13:28849978-28850000 CACCTGAGGTTTCTATAGAATGG - Intronic
1106373928 13:29165252-29165274 TAGCCGAGATCTGTGAAGAATGG - Intronic
1107020445 13:35745657-35745679 TTCTTGAGTTTTCTGAAAAAGGG + Intergenic
1108893511 13:55293998-55294020 TACCTGAGACTTCTGTAGCCTGG - Intergenic
1109500542 13:63231551-63231573 AACCTGGAATTTCTGAATAAAGG - Intergenic
1109908606 13:68878821-68878843 TACATGAAATTTCTACAGAAAGG - Intergenic
1111186316 13:84740775-84740797 TACTTGTGATTTCTGTATAAGGG + Intergenic
1111732018 13:92088245-92088267 TACCCCATATTTTTGAAGAACGG + Intronic
1111941878 13:94617957-94617979 TTTCTGAAATTTCTGAAAAATGG + Intronic
1112098618 13:96163064-96163086 TAGCTGCGAATTCTTAAGAAAGG + Intronic
1115141187 14:30173294-30173316 GACCTTAGACTTCTGAAGGAAGG - Intronic
1115153480 14:30312374-30312396 TACCTGAGATCTTAGAAGCAAGG - Intergenic
1115426899 14:33270801-33270823 GACCTGAGATATCTGCAGACAGG - Intronic
1116408190 14:44592215-44592237 GACCTGATCTTTCTGTAGAAGGG + Intergenic
1117203420 14:53415695-53415717 TGCCTCAGATTTCTGAAGCTGGG - Intergenic
1123670503 15:22651995-22652017 TACCCCATATTTTTGAAGAATGG + Intergenic
1124526485 15:30458434-30458456 TACCCCATATTTTTGAAGAATGG + Intergenic
1124724886 15:32147952-32147974 TACTTTAAATCTCTGAAGAAAGG - Intronic
1124772169 15:32549249-32549271 TACCCCATATTTTTGAAGAATGG - Intergenic
1125406492 15:39357584-39357606 TACCTGAGACTTCATAAGTAAGG + Intergenic
1125771765 15:42172425-42172447 TGCCTGAGAGATCTGAAGCAAGG + Intronic
1125820281 15:42624052-42624074 TACCTGACATTTATGAAGTGTGG + Intronic
1128530601 15:68443139-68443161 TAGGTGAGAATTCTGAAGCACGG - Intergenic
1135477864 16:22793596-22793618 TTGCTGAGATGTCTGGAGAAAGG + Intergenic
1137795281 16:51212355-51212377 CCCCTGAGACCTCTGAAGAAGGG - Intergenic
1138756693 16:59494876-59494898 TACCAGTTTTTTCTGAAGAATGG - Intergenic
1141721193 16:85756211-85756233 TGCCTGAGATTTCAGACGGATGG + Intergenic
1144328873 17:14206744-14206766 CACCAGAGATTTCCAAAGAATGG - Intronic
1146130490 17:30269689-30269711 GAGCTGAGATTACTGACGAATGG + Intronic
1146814249 17:35929790-35929812 AAGCTGAGATTTCTTAAAAAGGG + Intronic
1147236040 17:39058297-39058319 AAGCTGAGATTTCTTAAAAAGGG - Intergenic
1148022450 17:44562411-44562433 TAACTGGGTTTTCTGAACAAGGG - Intergenic
1149692310 17:58588244-58588266 TACCAGAGAATTCTGATGGACGG - Intronic
1150533983 17:66015848-66015870 CAACTGATATTTCTGAAGGAAGG - Intronic
1153652953 18:7257292-7257314 AGCCTGAGAATTCTGAAGAAAGG - Intergenic
1155343100 18:24832473-24832495 TTCCACAGATTTCAGAAGAAAGG + Intergenic
1155714521 18:28925048-28925070 TATCTGAGATTTAGGAAAAATGG - Intergenic
1155761380 18:29572286-29572308 TACCTAAGGTAACTGAAGAAAGG + Intergenic
1155965042 18:32027873-32027895 TACTTGAGGTTACAGAAGAATGG + Intronic
1156294683 18:35778745-35778767 CAGCTGAGACTGCTGAAGAAGGG - Intergenic
1157266805 18:46231327-46231349 TACTTCAGAATTCTGAAGATGGG - Intronic
1158433758 18:57417807-57417829 TACTTGATATTTCTTAAGAATGG - Intergenic
1159001327 18:62978072-62978094 TACCTGGGGTTTCTGATGACAGG + Intronic
1163904455 19:20138970-20138992 AACATGAGCTTTATGAAGAAAGG + Intergenic
1165280575 19:34793848-34793870 TTCATGAGTTTTCTGAAAAAGGG + Intergenic
926392730 2:12410442-12410464 TACTTGAGAAGTCTGAAGTAGGG - Intergenic
926722221 2:15969312-15969334 TAGCTGAGATTGTTGATGAAGGG - Intergenic
926848178 2:17165304-17165326 TACTTCTGAATTCTGAAGAACGG - Intergenic
927667766 2:25043964-25043986 TACCCGAGATATCTGAAGGTGGG + Intronic
928127151 2:28624911-28624933 AAGCTGAGATTTCTTGAGAATGG + Intronic
930313869 2:49773292-49773314 TACCTGAAATATTTGAGGAAGGG - Intergenic
932012302 2:67990818-67990840 TAGGTGAGATTTGTGATGAAAGG - Intergenic
933416231 2:81990028-81990050 AACCTGAGGTTTCTGGAGCACGG + Intergenic
935609481 2:105006173-105006195 TTCCTCACAATTCTGAAGAATGG + Intergenic
936452152 2:112641775-112641797 CTCTTGAGATTTCTCAAGAAAGG - Intergenic
936680953 2:114770556-114770578 TAACTGAGATTACTAAATAAAGG - Intronic
937001957 2:118475768-118475790 GAGCTGAGAGTTCTGAAGGAGGG + Intergenic
937014704 2:118594569-118594591 AACCTAAGAGTTCTGAGGAAGGG - Intergenic
937604956 2:123788405-123788427 TATATGAGATTTATGAAGAAAGG - Intergenic
938366662 2:130739696-130739718 TACTAGAGAGTTCTGCAGAAGGG + Intergenic
939202126 2:139050506-139050528 TAGTTGAGAGTACTGAAGAATGG - Intergenic
940363344 2:152819354-152819376 TCCTGGAGATTTCTGAAAAAGGG + Intergenic
940537531 2:154965309-154965331 GACATGAGATATCTAAAGAAAGG - Intergenic
941091636 2:161183170-161183192 TAACAATGATTTCTGAAGAATGG - Intronic
941284408 2:163591754-163591776 TACCTGAGATTTTTACAGATGGG + Intergenic
943392517 2:187287551-187287573 TTCTTGAGATTTTTGAATAATGG - Intergenic
943796843 2:192007059-192007081 TAGCTGAGATTTCTCAATAGGGG - Intronic
945966618 2:216194472-216194494 GATCTGAGATTTCTAAAGAAGGG + Intronic
946340374 2:219062717-219062739 TACCTCAGATTTCTGGAACAGGG + Intergenic
947174984 2:227356751-227356773 TAACTCAGAAATCTGAAGAAGGG + Intronic
948357705 2:237393207-237393229 TGCCTGAGATATCTGCAGAAAGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1171408470 20:24929638-24929660 TACATGGGGTTTCTAAAGAATGG + Intergenic
1172435254 20:34924518-34924540 AGCTTGAGATGTCTGAAGAATGG + Intronic
1172954525 20:38746801-38746823 TACTTCAGATATCTGAACAATGG + Intergenic
1178129150 21:29550152-29550174 TACTTGAGATTTCTCCAGGAAGG + Intronic
1181363050 22:22353594-22353616 TTACTGAGACTTCAGAAGAATGG - Intergenic
1182917219 22:34045655-34045677 TACTGGTGATTTTTGAAGAAAGG + Intergenic
1203295026 22_KI270736v1_random:33791-33813 TTTTTGAGATTTTTGAAGAAGGG - Intergenic
951846444 3:27089643-27089665 TACCTGAGAATTCTCAAGCTTGG - Intergenic
953254458 3:41276266-41276288 TTCCTCAGAGCTCTGAAGAAAGG - Intronic
955474110 3:59317771-59317793 CAGCTTAGATTTCTGTAGAAAGG + Intergenic
960965523 3:123101730-123101752 TGCCTGATAATTCTAAAGAACGG + Intronic
965209775 3:165770028-165770050 TTCCTGACATTGCTGAAGAGGGG - Intergenic
965302716 3:167022555-167022577 TACTTGAGATTGCTGAATAGAGG + Intergenic
965545750 3:169914843-169914865 AACCTGGTATTTCAGAAGAAAGG + Intronic
966306325 3:178539689-178539711 TAACTCAGGTTTCTGAAAAAAGG + Intronic
966745342 3:183269611-183269633 TTTCTGAGATTGCGGAAGAATGG - Exonic
966780600 3:183580947-183580969 TCCCTGAGATTTCTGCAAATGGG + Intergenic
969287037 4:6209272-6209294 AACCAGAGATGTCTGAATAAAGG + Intergenic
973190837 4:47383606-47383628 TAACTGAGAGATGTGAAGAATGG + Intronic
973215792 4:47667814-47667836 TTCCTGTGATTTGTGAAGGAGGG + Intronic
974066228 4:57080189-57080211 TGAATGAGATTTCTGAAGACTGG + Intronic
974519847 4:62969772-62969794 TACCAGAGGTGTCTGATGAAAGG + Intergenic
975817175 4:78230471-78230493 TATCTAAGCTGTCTGAAGAAGGG + Intronic
975865756 4:78722183-78722205 AACCTGAGATTTCTCCAGATTGG + Intergenic
976126534 4:81839106-81839128 TTCCTGAGAATTTTGAAGGAAGG - Intronic
976222828 4:82771767-82771789 TAACTTAGATTTCAGAAAAAAGG - Intronic
976344186 4:83981031-83981053 AACCTAAGAATTCTGAATAATGG - Intergenic
976671290 4:87657054-87657076 AATCTGAGGATTCTGAAGAATGG + Exonic
977895731 4:102362859-102362881 TAGCAAAGATTTCTGAAGATAGG - Intronic
978227312 4:106352895-106352917 TGCCTAGGATTGCTGAAGAATGG + Intergenic
978309920 4:107375795-107375817 TACATGAGATTACTGAGGCAAGG - Intergenic
979036585 4:115727250-115727272 TAACTAAGATTTCAGATGAATGG - Intergenic
980516729 4:133872262-133872284 TGCCTGAAATTTGTCAAGAAGGG - Intergenic
981305221 4:143240105-143240127 TTCATGAGCTTTCTGAGGAAAGG - Intergenic
982345891 4:154357911-154357933 CACCTGAGAAATCTGAAGAAAGG - Intronic
987733794 5:21811958-21811980 TAACTGAGAAGACTGAAGAAAGG - Intronic
987832535 5:23114769-23114791 TCCCTGAGAGTTCTCCAGAAAGG - Intergenic
987861491 5:23492822-23492844 TCCCAGAGATTCCTGACGAAGGG - Intergenic
989529676 5:42493254-42493276 AAGCTGGGATTTCTGTAGAATGG + Intronic
993418199 5:87662566-87662588 TGTCTGTGATTTCTGGAGAATGG + Intergenic
993549565 5:89256910-89256932 TTCCTCAGCCTTCTGAAGAAAGG - Intergenic
993569490 5:89519560-89519582 TTTCTGGGATTTCTGATGAACGG + Intergenic
993664354 5:90677284-90677306 TACCTGAGATTTGGGAACACAGG - Intronic
993968089 5:94382566-94382588 AACCTTAGATTTTTAAAGAATGG - Intronic
994489409 5:100422659-100422681 TTCCTGAGATTTTAGAAGCATGG - Intergenic
995375763 5:111472547-111472569 TACCTTAGATTTGTGAAAATGGG - Intronic
996939415 5:128986008-128986030 TGCCTGAGAATTCAAAAGAAGGG + Intronic
997934433 5:138098070-138098092 TCCCTGGGATATCTGAAGACAGG - Intergenic
998540368 5:142975731-142975753 TCCCTGAGATTACTTAATAAAGG + Intronic
1000675525 5:164118022-164118044 TACTTGAGATTTATGCAGATTGG + Intergenic
1000964730 5:167642269-167642291 TACCTGATATTTCAGAAAAATGG - Intronic
1001310088 5:170604201-170604223 GACCTGAGATTTCCCTAGAATGG - Intronic
1002986866 6:2198278-2198300 TACATGTAATTCCTGAAGAAGGG + Intronic
1003391775 6:5719544-5719566 TACCTGAGATTTCTGAAGAAAGG - Intronic
1004177719 6:13354605-13354627 TGCCTGAGATATCTGAAGTAGGG - Intergenic
1004735975 6:18406834-18406856 TACCTGAGATCTATAAAGGAAGG + Intronic
1005528540 6:26677633-26677655 TGACTAAGATCTCTGAAGAAGGG + Intergenic
1005529314 6:26686782-26686804 TGACTAAGATCTCTGAAGAAGGG + Intergenic
1005531382 6:26710078-26710100 TGACTAAGATCTCTGAAGAAGGG + Intergenic
1005539414 6:26791560-26791582 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1005541482 6:26814864-26814886 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1005542255 6:26824006-26824028 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1009010239 6:57833737-57833759 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1009012290 6:57856924-57856946 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1009013063 6:57866095-57866117 TGACTAAGATCTCTGAAGAAGGG - Intergenic
1011051324 6:83153601-83153623 TACCTGTGATTTCTGAGGTAGGG - Exonic
1013702926 6:112795710-112795732 TAGATGAGATTTCTTTAGAATGG + Intergenic
1013892583 6:115043214-115043236 TACCTGAGGTTTCTAAGGAGTGG - Intergenic
1014004877 6:116406672-116406694 TACCTTAGGTATCTTAAGAATGG + Intronic
1014155625 6:118105997-118106019 TAACTGAGATTTGAGAAGATTGG - Intronic
1014208727 6:118685933-118685955 AACCTGAGAGTTCTGAAAATAGG + Intronic
1014281500 6:119446871-119446893 TACTTAAGATTTCAGAAGACTGG - Intergenic
1015868707 6:137754021-137754043 CACCTGAGAATTCAGAAGAGAGG - Intergenic
1016369528 6:143357992-143358014 GGCCTGTGATCTCTGAAGAAAGG + Intergenic
1016385884 6:143530448-143530470 AAACTGAGATTTATGTAGAAGGG - Intergenic
1019046299 6:169149986-169150008 TAACTGACATTTAAGAAGAATGG - Intergenic
1019180680 6:170185913-170185935 AAGCCGAGATGTCTGAAGAAAGG - Intergenic
1020815669 7:12902469-12902491 CACTTCAGATTTTTGAAGAAAGG + Intergenic
1020861715 7:13501641-13501663 TACCTGAGATCTTAGAATAAAGG - Intergenic
1022289173 7:28984888-28984910 TCCCTGAGAATTGTGAAGCAAGG + Intergenic
1022880889 7:34586300-34586322 TACAGGACATTTCTGATGAAGGG + Intergenic
1023060980 7:36326641-36326663 TACTTGTGTTTTCTGAAGAAGGG - Exonic
1024225150 7:47320867-47320889 TCCCTGAGAACTCTGAAGTAGGG - Intronic
1024342426 7:48280952-48280974 AACCTGAGATTGGTGGAGAATGG - Intronic
1027343155 7:77231399-77231421 TATCTGTGAATTGTGAAGAAGGG + Intronic
1028430577 7:90742935-90742957 TACATGAGATATCTTAGGAAGGG + Intronic
1029531773 7:101130221-101130243 GATCTGAGACTTTTGAAGAAAGG + Intronic
1030092941 7:105873786-105873808 CACCTGTGACTTCTGAGGAAAGG + Intronic
1030732373 7:113005369-113005391 TAACAGACATTTCTGAAGACAGG + Intergenic
1031402610 7:121343580-121343602 TATTTGAGGTTTCTGAAGATAGG - Intergenic
1031974651 7:128086041-128086063 TGCCTGAGGTCTCTGCAGAATGG + Intronic
1032369708 7:131334911-131334933 TATCAGAGATTTCTGACAAATGG - Intronic
1033128919 7:138728758-138728780 TACCTGGGATTTCCGATGACTGG + Exonic
1033186777 7:139233285-139233307 GACCTCAGATTTATAAAGAAGGG - Intronic
1033994796 7:147332148-147332170 TACCTCACATTAATGAAGAAGGG + Intronic
1034516340 7:151583368-151583390 TATATGAGATCTCTGAAGGATGG - Intronic
1034750455 7:153563471-153563493 TACGTGAGATTTCTCACGAAAGG + Intergenic
1038652514 8:29418559-29418581 AATCTAAGTTTTCTGAAGAAGGG + Intergenic
1039023055 8:33228635-33228657 TACCTGTGAGTTGTCAAGAATGG + Intergenic
1039501299 8:38019703-38019725 AAACAGAGCTTTCTGAAGAAAGG + Intergenic
1043294901 8:78650171-78650193 TTACTGAGATTTCTAATGAAAGG + Intergenic
1043741723 8:83822402-83822424 AACATGAGATTACTGAATAATGG - Intergenic
1044116450 8:88341601-88341623 TACCTGAGAGTTCAAAAGCAGGG - Intergenic
1044132205 8:88538049-88538071 AATCTGAGATTTTTGAGGAAGGG - Intergenic
1044337216 8:91001233-91001255 TACCTGAGAAATCTGAATATTGG - Intronic
1047629497 8:126691741-126691763 TCTCTGAAAATTCTGAAGAAAGG - Intergenic
1050409826 9:5351381-5351403 TACCTGAGATTCCAGAAGACAGG - Intergenic
1050813334 9:9777997-9778019 TAGCTGTGATTCCTCAAGAAAGG + Intronic
1051429897 9:16971147-16971169 TACCTGAGAACTCAGAAAAAAGG - Intergenic
1051711896 9:19939877-19939899 TGCCAGGGATTTCTGGAGAAGGG - Intergenic
1053103627 9:35391922-35391944 TAGCTGAGATTTCTTTTGAAAGG + Intronic
1056851395 9:90087541-90087563 TACCTGAGATACCAGGAGAAAGG + Intergenic
1058571121 9:106345877-106345899 TTCCTGAGATTTATCAAGGAGGG - Intergenic
1058949625 9:109891394-109891416 TACCTGACATTACTTAATAATGG - Intronic
1059807716 9:117821963-117821985 TACCTGTGTTATCTGAACAATGG - Intergenic
1061772723 9:132938776-132938798 TACCTAAGATGTCTTTAGAATGG + Intronic
1185992222 X:4903986-4904008 TACATGAGCTTTATGAAGGAGGG + Intergenic
1186989670 X:15053871-15053893 TACCTGTTATTTCTGATTAATGG - Intergenic
1187227002 X:17383030-17383052 TACTTGAGAATTCTGAGAAATGG - Intronic
1187853849 X:23617772-23617794 AATCTGAGGTATCTGAAGAAAGG + Intergenic
1188107375 X:26160776-26160798 TCCCTGAGACTCCTGAGGAACGG - Intergenic
1188110770 X:26194022-26194044 TCCCTGAGACTCCTGAGGAATGG - Exonic
1188110790 X:26194148-26194170 TCCCTGAGACTCCTGAGGAACGG - Exonic
1188110808 X:26194274-26194296 TCCCTGAGACTCCTGAGGAACGG - Exonic
1188566125 X:31528644-31528666 TACATGAGATATATGCAGAATGG - Intronic
1189279872 X:39813513-39813535 TATCTGACATTTCTGAAGCAGGG - Intergenic
1189999286 X:46669708-46669730 TACATGAGATTTCTGTAAGAAGG + Exonic
1193241009 X:79169387-79169409 TACCCGAGATTTCTCAGGTAAGG - Intergenic
1195176210 X:102317699-102317721 TAGCTTAGATTTCTAAAGAAAGG - Intronic
1195182654 X:102369394-102369416 TAGCTTAGATTTCTAAAGAAAGG + Intronic
1195378212 X:104248199-104248221 TATCTAAGATTTCTGCAGCAAGG - Intergenic
1195466753 X:105187833-105187855 TACCTGAAAATTGTGAAGAAAGG + Intronic
1195520652 X:105824288-105824310 TACATGAGATTTCCGGAAAATGG + Intronic
1196428281 X:115594938-115594960 TACCTTAGCTTTCTGAAGCTAGG + Intronic
1197389725 X:125845552-125845574 TGCGTAAAATTTCTGAAGAAAGG - Intergenic
1199741947 X:150743938-150743960 TTCCTGACATTTCTGAAAAATGG + Intronic