ID: 1003392083

View in Genome Browser
Species Human (GRCh38)
Location 6:5723043-5723065
Sequence GTTGGGGAAGACTCCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003392077_1003392083 5 Left 1003392077 6:5723015-5723037 CCCTGAGAGAGGGCAGGCAGGAG 0: 1
1: 0
2: 6
3: 64
4: 523
Right 1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG 0: 1
1: 0
2: 1
3: 20
4: 194
1003392078_1003392083 4 Left 1003392078 6:5723016-5723038 CCTGAGAGAGGGCAGGCAGGAGG 0: 1
1: 1
2: 7
3: 111
4: 756
Right 1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG 0: 1
1: 0
2: 1
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003392083 Original CRISPR GTTGGGGAAGACTCCACAGA TGG Intronic