ID: 1003392083

View in Genome Browser
Species Human (GRCh38)
Location 6:5723043-5723065
Sequence GTTGGGGAAGACTCCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003392078_1003392083 4 Left 1003392078 6:5723016-5723038 CCTGAGAGAGGGCAGGCAGGAGG 0: 1
1: 1
2: 7
3: 111
4: 756
Right 1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG 0: 1
1: 0
2: 1
3: 20
4: 194
1003392077_1003392083 5 Left 1003392077 6:5723015-5723037 CCCTGAGAGAGGGCAGGCAGGAG 0: 1
1: 0
2: 6
3: 64
4: 523
Right 1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG 0: 1
1: 0
2: 1
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003392083 Original CRISPR GTTGGGGAAGACTCCACAGA TGG Intronic
901325771 1:8364328-8364350 GTTTGGGTAGAGCCCACAGAAGG - Intronic
901776547 1:11564013-11564035 GCTGGGAAATACCCCACAGAGGG - Intergenic
902862054 1:19253543-19253565 GTTGGGGAAGACAGGGCAGAGGG + Intronic
903534813 1:24059943-24059965 GGAGGGGAAGGCCCCACAGATGG + Intronic
903814358 1:26053904-26053926 GAAGAGGAAGAGTCCACAGAAGG - Exonic
904623848 1:31791145-31791167 GTTGGGGAAGGTTCAAAAGATGG - Exonic
905653256 1:39670647-39670669 GATGTGGAAGAGCCCACAGAGGG - Intronic
905753689 1:40488737-40488759 GTTGGGGAAGACTCTCTAAAAGG - Intronic
907962903 1:59299115-59299137 TTTGGGGAGGACTTCCCAGAAGG + Intronic
908813895 1:68011971-68011993 GGCGGTGAAGACTTCACAGAAGG - Intergenic
909188858 1:72525719-72525741 GTAGGGTAATACTCTACAGAAGG + Intergenic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
915387683 1:155511408-155511430 GTTTGGAAAGTCTCCAGAGAGGG - Intronic
916914095 1:169387048-169387070 GTTGGTGAAGACTCAAAAAATGG - Exonic
1064256776 10:13749062-13749084 GTGGGTGCAGACGCCACAGATGG - Intronic
1067981950 10:51097037-51097059 TTTGGGGAAGACCCCACTGTAGG - Intronic
1071259761 10:83909183-83909205 GTCGGGGAAGATTGCACAGCTGG + Intergenic
1075129292 10:119725296-119725318 TTTGGAGAAGACTTCACAAATGG - Intergenic
1075131669 10:119745261-119745283 GTGGGTGAAGAATCCACAGGAGG - Intronic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1078341987 11:10503941-10503963 GGTGGGGAAGAGGTCACAGACGG + Intronic
1078473284 11:11609260-11609282 GTAGGGGAAGAAGCCAGAGAGGG - Intronic
1078550716 11:12278822-12278844 GGTGGGGAAGATTTCAGAGAAGG + Intronic
1081840404 11:46196584-46196606 TTTGGGGAAGACTCCAGATTGGG + Intergenic
1083148816 11:60777224-60777246 CTTTGGGAAGACTTCACAGAAGG - Intergenic
1083984992 11:66208197-66208219 TTAGGGGAAAACTCCACACATGG - Intronic
1084943239 11:72625498-72625520 GTTGAGGAAGACTTCCCAGATGG + Intronic
1088728528 11:112660182-112660204 GCTGTTCAAGACTCCACAGAAGG + Intergenic
1088742971 11:112781752-112781774 GTTGGGGAAGATTCTCCAAAGGG + Intergenic
1092837382 12:12503525-12503547 GTGGAGGAAGGCCCCACAGATGG - Intronic
1092876899 12:12856313-12856335 ATTGGGAAAGCATCCACAGAGGG - Intergenic
1093341760 12:17983966-17983988 GTTCGGGAAGATTACACATAAGG + Intergenic
1093683421 12:22029678-22029700 GATGGGGAGGATTCCACAGCCGG + Intergenic
1096077820 12:48815819-48815841 TTTGGGGGAGACTGCACCGATGG + Intronic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1104792815 12:131494297-131494319 GGTGGGGCAGAGTCCACAGAAGG + Intergenic
1106490709 13:30218813-30218835 GTTGGGGGTGACTCCACAGCTGG - Intronic
1108754585 13:53484674-53484696 GTTGGGGAAGCCACCAAACAGGG + Intergenic
1110003422 13:70234761-70234783 TTTGGGGATGAGTCCAGAGATGG + Intergenic
1111600947 13:90473230-90473252 GTTGGAGAAGAGTTCACAAAGGG - Intergenic
1113780068 13:112971521-112971543 GTTGGGGGTGAATCTACAGAGGG - Intronic
1115160436 14:30387679-30387701 GTTGAGGGAGACTCCCCAGAAGG + Intergenic
1119650965 14:76382438-76382460 GGTGGGGCAGACCCCAGAGAGGG + Intronic
1119734297 14:76971653-76971675 GTCGGGTGGGACTCCACAGATGG + Intergenic
1119812124 14:77530958-77530980 GTTAGGGAAGAATTCACAGTAGG - Intronic
1121308954 14:92924421-92924443 GCTGGGGAAGTCCCCACAGCAGG - Intronic
1125321576 15:38494554-38494576 CTTGGGGAAGACAGCACAAAGGG + Exonic
1129318287 15:74759435-74759457 GCTGGAGAAGACCTCACAGAAGG - Intergenic
1129591556 15:76919482-76919504 TTTGGTGAAGACTAAACAGAGGG - Intergenic
1131124581 15:89848167-89848189 TTTGAGAAAGACTCCACAGTAGG - Intronic
1131312800 15:91306142-91306164 GTTGGAGAAGATTCTAGAGAAGG + Intergenic
1132520339 16:384322-384344 GGTGGGTAAGAATCCCCAGACGG + Intronic
1132827771 16:1913642-1913664 GTGGGGGAAGCCCCCTCAGAGGG - Intronic
1133370627 16:5243214-5243236 CTTGGGGAAGGCTCAACAAATGG - Intergenic
1134370590 16:13620467-13620489 GTTGGGGAAGAAACCATACAGGG - Intergenic
1134778184 16:16871228-16871250 GTCGGTGAAGACTTGACAGAGGG - Intergenic
1135122480 16:19778333-19778355 GTTAGTGCAGACCCCACAGAAGG - Intronic
1135132065 16:19861434-19861456 GCTGGGGAGGAGTCAACAGAGGG + Intronic
1137280821 16:46974928-46974950 GTAAAGGAAGACTTCACAGAGGG - Intergenic
1137392633 16:48093905-48093927 ATTAGAGAAGACTCCCCAGATGG - Intronic
1137792940 16:51190185-51190207 ATTAGGGAAAACTCCACGGAGGG + Intergenic
1138179063 16:54930315-54930337 CTTGGGGAAGACGCCAGAGGGGG + Intergenic
1139549962 16:67667565-67667587 GTTGGGGCACACACCACAGTAGG + Intronic
1142624177 17:1181378-1181400 GGTGGGGAAGCCTCTACAGGTGG + Intronic
1143404413 17:6667733-6667755 GTGGGGGAAGGTGCCACAGAGGG + Intergenic
1144968117 17:19090363-19090385 GTGGGTGAAGAAGCCACAGAAGG - Intergenic
1144979800 17:19161700-19161722 GTGGGTGAAGAAGCCACAGAAGG + Intergenic
1144988422 17:19216532-19216554 GTGGGTGAAGAAGCCACAGAAGG - Intronic
1146063798 17:29620520-29620542 GTTAGGGTAGGCTCCACAGGTGG - Intronic
1146833619 17:36091834-36091856 GTTGGGGAAGGCTTCATGGAAGG + Intergenic
1146848202 17:36198663-36198685 GTTGGGGAAGGCTTCATGGAAGG + Intronic
1147320620 17:39643661-39643683 GTTAATGGAGACTCCACAGAGGG - Intronic
1147744592 17:42687535-42687557 GTTGGGGCCCCCTCCACAGATGG + Intronic
1149336341 17:55640170-55640192 GTTGAGAAAGGCTTCACAGAGGG - Intergenic
1150198839 17:63332055-63332077 ATTCAGGAAGACTCTACAGATGG - Intronic
1150904722 17:69326012-69326034 TTTAGGGAAGACTCCATAGTAGG - Intronic
1151407079 17:73895362-73895384 GTTGGGGAAGGGACCACAGAGGG + Intergenic
1151941983 17:77298464-77298486 GGTGGGGAAGGCTCCCCAGGAGG - Intronic
1152232645 17:79122018-79122040 GATGGGGAAGACCTCAGAGATGG - Intronic
1153537530 18:6118092-6118114 CATGGGGAAGAGGCCACAGATGG - Intronic
1157224797 18:45853018-45853040 GGTGGGGAGGACCCCACAGGTGG - Intronic
1157952738 18:52057860-52057882 GCTGGAGAAGACTACAAAGAGGG - Intergenic
1161324507 19:3656946-3656968 CTCAGGGAAGGCTCCACAGATGG + Intronic
1161354823 19:3813214-3813236 GTTCTGGAAGATTCCACAGCTGG + Intronic
1161553042 19:4924757-4924779 GATGAAGATGACTCCACAGAGGG - Intronic
1161596319 19:5152740-5152762 GGTGGGGAAGGCTCCCCAGAGGG - Exonic
1161747799 19:6071959-6071981 GTTGGGGATGACTTCAGACAGGG + Intronic
1162337301 19:10069881-10069903 GTTGGGGAAGGCTTCCCAGAGGG + Intergenic
1163289526 19:16370359-16370381 GCTGGGGCAGACGCCTCAGAAGG - Intronic
1165848772 19:38836811-38836833 GTTTGGGGAGCCTCCAAAGACGG - Intronic
1166725104 19:45022143-45022165 GTGGGGAAAGACTGCACCGACGG + Exonic
1166816091 19:45547086-45547108 GGGAGGGAGGACTCCACAGAGGG + Intronic
1166955248 19:46459871-46459893 GTTGGGTAAGGTTCCACTGAAGG + Intergenic
1167198190 19:48045073-48045095 GGTGGGGATAAATCCACAGATGG + Intergenic
1167380172 19:49133885-49133907 GGGGCGGAAGACTGCACAGAGGG + Intronic
926129100 2:10289877-10289899 GATGGGGCAGCCCCCACAGAGGG + Intergenic
927441296 2:23119800-23119822 GTTGGGGAAGAGGGAACAGAAGG - Intergenic
929235261 2:39598336-39598358 GCTGGGGAAGCCTGCACAGTGGG - Intergenic
929927468 2:46227042-46227064 ATTGGGAAAGACTTCACTGAAGG + Intergenic
930095484 2:47562990-47563012 CTTGGGGAGGACTCCAGAGCTGG + Intronic
931293097 2:60894481-60894503 GTTGGAAAAGACTGCAGAGACGG + Exonic
933750588 2:85600251-85600273 GGTGGGGAGGGCTGCACAGAAGG + Intronic
935318825 2:101865066-101865088 GCTGTGGTAGACTGCACAGAAGG - Intronic
937336123 2:121063408-121063430 AGTGGGGAAGATTCCAGAGAGGG - Intergenic
938137422 2:128770616-128770638 CTTGGAGAAGACTCCTCAGTGGG + Intergenic
938225319 2:129610951-129610973 CTTGAGGAGGGCTCCACAGATGG - Intergenic
940881187 2:158948305-158948327 GCTGAGGAAGAGACCACAGAGGG + Intergenic
941017511 2:160373922-160373944 GTTGAGGAAGGCTTCACAGAGGG + Intronic
941078026 2:161028605-161028627 GTTAGGGAAGGCTCCCCTGAAGG + Intergenic
947411681 2:229847980-229848002 GTGGGAGAAGAGGCCACAGATGG - Intronic
947967507 2:234293989-234294011 GTGGGGAAAGACTGTACAGAGGG - Intergenic
1169388870 20:5173417-5173439 GTGGGGAAAGACTCCAAACAGGG - Intronic
1169760003 20:9080917-9080939 GATGGGGTAGACTCAACAGATGG - Intronic
1170166704 20:13367040-13367062 GATGGGGAAGCCTCCATAAAAGG - Intergenic
1171795759 20:29565820-29565842 GTTGGGGAAGACTGTGCAAAAGG + Intergenic
1172093262 20:32448211-32448233 GCTGGGGAAGAGCACACAGATGG - Intronic
1173144402 20:40512285-40512307 GTTGGGGAGGAGACTACAGAAGG - Intergenic
1173225708 20:41161460-41161482 GATGGGAAAGAGACCACAGAGGG + Intronic
1173810397 20:45951854-45951876 GCTGGGGAAAATGCCACAGAAGG - Intronic
1174347422 20:49940745-49940767 GGAGGGGAAGACTGCAGAGACGG - Intronic
1177209285 21:18050159-18050181 CTTAGGAAACACTCCACAGAGGG + Intronic
1179370685 21:40803821-40803843 GTTGGGGAAAATCCCACAGCTGG + Intronic
1179518290 21:41925077-41925099 GTTGGGGAAGACACGCCAGGGGG - Intronic
1179524889 21:41969415-41969437 GATGGGGTAGCCTCAACAGATGG + Intergenic
1179708487 21:43195859-43195881 GTTGGGGAAGAGTGAACAGAGGG + Intergenic
1182362611 22:29755819-29755841 CATGGTGAAGACTCCACAGGAGG - Intronic
1182964692 22:34510020-34510042 GTAGGTGAAGCCTCCCCAGAGGG - Intergenic
1182990466 22:34762773-34762795 GTTTGGGAAGATTTCCCAGAAGG - Intergenic
949126473 3:450935-450957 ATTGGGAAAGGCTTCACAGAGGG + Intergenic
950733068 3:14979650-14979672 GGTGGGGAACACTCCAGACAGGG + Intronic
952155332 3:30637383-30637405 GCTGGAAAAGATTCCACAGAGGG + Intronic
952293679 3:32042208-32042230 GGTGGGGGTGACCCCACAGATGG - Intronic
953917986 3:46932805-46932827 GTAGGGGCAGCCTCCACACATGG + Intronic
958124503 3:89338365-89338387 GTTGGAAGAGACTCCACAGAAGG - Intronic
960438621 3:117658852-117658874 GATGGGGAAGATGCCAGAGAAGG - Intergenic
962344291 3:134608182-134608204 GTTGGGGAAGAGAACACAGCAGG + Intronic
965560726 3:170059968-170059990 GGTGAGGAAGACTCCTGAGATGG + Intronic
966404863 3:179585993-179586015 GTTGGGGAGGACTACAGAAAGGG + Intronic
968915723 4:3496330-3496352 GGTGGGGAAGGCTCCGCAGGGGG - Intronic
972779763 4:42276829-42276851 GTTGGGGAAGATTGTGCAGAAGG + Intergenic
973126741 4:46595345-46595367 TTGTGGGAAGACACCACAGAGGG - Intergenic
973910490 4:55575094-55575116 GTTAGGGAAGACCCCACATTGGG - Intronic
975541209 4:75514168-75514190 GTCAGGGAAGAGTCCATAGAAGG + Intronic
976411929 4:84723744-84723766 GTTGGAGAAGACTTTAGAGAAGG + Intronic
977245540 4:94626150-94626172 GATGGTGAAAACTCCTCAGATGG - Intronic
981087303 4:140697450-140697472 CTTATGGAAGACTGCACAGAAGG - Intronic
981642003 4:146955232-146955254 GTAATGGAAGACTTCACAGAGGG + Intergenic
983262208 4:165469574-165469596 GTAGAGGATGACTTCACAGAGGG - Intronic
984351787 4:178603583-178603605 GATGGGGAAAATTCCACAGTTGG + Intergenic
986043518 5:4016168-4016190 GTTAGGGAAAACTACACATAAGG - Intergenic
989108830 5:37887999-37888021 ATTGGGGTAAACTCCGCAGAGGG + Intergenic
990355585 5:54962977-54962999 GTTGAGGAAAAACCCACAGAAGG + Intergenic
1001380152 5:171300650-171300672 GCTGGAGAAGACTCGGCAGACGG + Intergenic
1002062462 5:176633921-176633943 GCTGGGGCAGACTCCAGAGGAGG + Intronic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1005005188 6:21280976-21280998 GCTGGGGAAAACTGCACAGAAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006150214 6:31983056-31983078 GGTGGGTCAAACTCCACAGAGGG - Intronic
1006156515 6:32015794-32015816 GGTGGGTCAAACTCCACAGAGGG - Intronic
1008390941 6:50951025-50951047 GTTAGGGAAGACTCCATGAATGG - Intergenic
1010518961 6:76809766-76809788 GTTGGGGAAAACTCTAAGGATGG + Intergenic
1012051613 6:94352498-94352520 GTTGGGGAGGAGGTCACAGAGGG - Intergenic
1012519733 6:100106506-100106528 GGTGGGGAAGGCTCCCCATAGGG + Intergenic
1012701405 6:102461442-102461464 GTTGGGGAAGAGTACACACCAGG + Intergenic
1013791086 6:113837339-113837361 CTTGTGGGAGACTCCACAGCTGG + Intergenic
1014930503 6:127330298-127330320 GTTAGGGAAGATTCCACAGCTGG + Intronic
1018028434 6:159823212-159823234 CTTGGGGCAGAATCCACAGAAGG - Intergenic
1018090758 6:160345792-160345814 GTTGCGGAAGACTTTAAAGAGGG + Intergenic
1019495866 7:1340398-1340420 GCTGGGGCAGATTCCTCAGAAGG + Intergenic
1019507105 7:1397018-1397040 TTTTGGGAAAACTCCACTGATGG - Intergenic
1019522581 7:1467480-1467502 GATGGGGAAGACGCCTGAGAGGG - Intergenic
1023889694 7:44383271-44383293 GTTGGGAATGATTCCACTGAAGG - Exonic
1024512890 7:50217096-50217118 GTTGGGGAGGCCTTCACAGTCGG - Intergenic
1025596500 7:62934053-62934075 GTTTTGGCAGAATCCACAGAGGG - Intergenic
1025774480 7:64547959-64547981 GTGAGGCAAGACTCCACAGTGGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1028966313 7:96805592-96805614 CTTGGGGAAAACTCAACAGGGGG - Intergenic
1029932727 7:104390359-104390381 GTTGGGGAACACTACACACTGGG - Intronic
1034226909 7:149491365-149491387 GTGAGGGAAGCCTCCACACATGG + Intronic
1034700342 7:153089957-153089979 GTTGGTGAAATCTCCTCAGAGGG - Intergenic
1035830979 8:2694114-2694136 CTTCGGGAAAACCCCACAGACGG - Intergenic
1036814048 8:11888035-11888057 GGTGGGGAAGACTTCAGAGGAGG + Intergenic
1037683806 8:21120546-21120568 GGTGGGGAAGCTTCCACAAAGGG - Intergenic
1041082546 8:54227187-54227209 GTGGAGGAAGAGACCACAGAGGG + Intergenic
1042375073 8:68040600-68040622 GTCAGGGAAGACACTACAGAGGG - Intronic
1045900639 8:107275408-107275430 GTTGGGGAATAGTTCAGAGATGG - Intronic
1045909290 8:107387132-107387154 GTCGGGAAAGGCTCCACAGAAGG + Intronic
1046275043 8:111947993-111948015 CTTGGAGAAGACTGAACAGAAGG - Intergenic
1046552502 8:115734345-115734367 GCTGGGGGTGACTCCACAGCTGG + Intronic
1046847653 8:118935989-118936011 GGATGGGAAAACTCCACAGATGG + Intronic
1047042127 8:121007733-121007755 GTTGGGGATGAAATCACAGAGGG + Intergenic
1048448235 8:134509053-134509075 GATGGTGAAGTCTCCACTGAGGG + Intronic
1050180600 9:2918396-2918418 CTGGGGGAAGACTCAAGAGAGGG - Intergenic
1050740536 9:8814401-8814423 GGAGGGGAAGACCCCACAGAAGG + Intronic
1053438525 9:38094463-38094485 GTTGGGGAATCCTGCACAAAAGG + Intergenic
1054955444 9:70904478-70904500 CTTGGGGAAGAGTGCAAAGAAGG + Intronic
1055928285 9:81533021-81533043 TTTGGGAAAGTCTCCAAAGAAGG + Intergenic
1056332383 9:85531953-85531975 GTTGGAGAAGACTTCACAGGAGG - Intergenic
1058054669 9:100437237-100437259 GTGGGGGAAGAGCCAACAGATGG + Intronic
1058110136 9:101023557-101023579 ATTAGGGCAGAGTCCACAGAAGG + Intergenic
1058263603 9:102870468-102870490 GCTGGTGAAGAATACACAGAAGG + Intergenic
1058402612 9:104635697-104635719 GTTTTGGAAGACTCCCTAGAGGG - Intergenic
1058840319 9:108901081-108901103 GTGGGAAAAGACTACACAGAAGG + Intronic
1059064002 9:111063540-111063562 GTTGTGGTAGAGACCACAGATGG + Intergenic
1059281319 9:113136522-113136544 TTTAGGGAAGACACCTCAGAGGG + Intergenic
1059287272 9:113185368-113185390 GTCAGGGAAGGCTTCACAGAGGG + Intronic
1059517436 9:114908856-114908878 CTTGGAGAAGACCCCAGAGAAGG + Intronic
1061119411 9:128634128-128634150 GTTGGGGAAAAGACCACACATGG - Intronic
1190246311 X:48692848-48692870 GGTGAGGGAGACTCCAGAGAGGG + Intergenic
1190339591 X:49286221-49286243 GGTGGGGAGGGCTCCACAGATGG + Exonic
1190844548 X:54180306-54180328 GTTGGGGAAGGCTTCACCGATGG - Intronic
1191738773 X:64415549-64415571 GTTGAGGAAGTTTTCACAGATGG + Intergenic
1194945384 X:100060470-100060492 ATTGGGGTAGACTTCATAGAGGG - Intergenic
1197700464 X:129595785-129595807 GATGGGGAAAAGTCCAGAGAGGG - Intergenic
1199727797 X:150602022-150602044 GCTGGGGAAGACTCCAGAGAGGG - Intronic