ID: 1003396152

View in Genome Browser
Species Human (GRCh38)
Location 6:5753825-5753847
Sequence GTGGCAGTCCAGCACCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003396149_1003396152 8 Left 1003396149 6:5753794-5753816 CCATTAAAACTTCTCATAGTTTT 0: 1
1: 0
2: 3
3: 41
4: 455
Right 1003396152 6:5753825-5753847 GTGGCAGTCCAGCACCATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 163
1003396148_1003396152 12 Left 1003396148 6:5753790-5753812 CCGGCCATTAAAACTTCTCATAG 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1003396152 6:5753825-5753847 GTGGCAGTCCAGCACCATGGTGG 0: 1
1: 0
2: 1
3: 9
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003396152 Original CRISPR GTGGCAGTCCAGCACCATGG TGG Intronic
900886776 1:5420889-5420911 ATGGTAATCCAGGACCATGGAGG + Intergenic
901677140 1:10892100-10892122 GTGACAGTCCAGGATGATGGTGG - Intergenic
902656469 1:17872543-17872565 GTGGGAGTCCAGCTCCAAGATGG - Intergenic
902723634 1:18321245-18321267 GTGGCTCTACAGCAACATGGAGG - Intronic
903943974 1:26950402-26950424 GTGTCTTTCCAGCACCATGCTGG + Intronic
904677816 1:32209101-32209123 GTGGCAGTCCAGCAGCCAAGAGG + Exonic
904799252 1:33081341-33081363 GAGGCAGGTCAGCACCAGGGCGG - Intronic
905319756 1:37107515-37107537 GTGGCCGCTTAGCACCATGGTGG + Intergenic
906087416 1:43147936-43147958 GTGGCAGCCCAAGGCCATGGCGG + Exonic
915343287 1:155187682-155187704 GCTGCAGCCCAGCACCATGCCGG - Intronic
917679627 1:177352770-177352792 GTAGCAGTGAAACACCATGGGGG - Intergenic
917759618 1:178141983-178142005 CTGGTAGTACAGCAGCATGGAGG + Intronic
919741742 1:200985027-200985049 GTGGAAGCCCAGCACCAAGTAGG - Intronic
922684127 1:227626089-227626111 CTGGTAGTACAGCAGCATGGAGG + Intronic
924758704 1:246964927-246964949 GTGGCAGTACTGCAAGATGGGGG + Intronic
924817025 1:247451602-247451624 GTAGCGGTCCAGGGCCATGGCGG + Exonic
1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG + Intronic
1064867421 10:19896641-19896663 ATGGCAGTTCTGCACAATGGTGG + Intronic
1065366110 10:24938506-24938528 CTGGCAGTGCACCACCTTGGTGG - Intronic
1068299425 10:55119366-55119388 GTGTCAGTCCAGCAAAATGTAGG - Intronic
1069713879 10:70508448-70508470 GTGGCAGTCCAGGAGCACGCTGG - Intronic
1069841804 10:71344467-71344489 GTGACAGCCCAGCTCCCTGGGGG - Intronic
1071315292 10:84389608-84389630 GTGGAACTTCAGCAGCATGGTGG + Intronic
1076297029 10:129393986-129394008 GGGGCAGGCAAGCGCCATGGAGG + Intergenic
1076997802 11:307412-307434 GTTGCAGTCCTGCTCCATGCGGG - Intergenic
1077017602 11:403852-403874 GGGCCAGTCCAGCTCCCTGGGGG + Intronic
1078511130 11:11985084-11985106 GTGGAACTCCAGCTCCAAGGAGG + Intronic
1079933389 11:26591644-26591666 CTGGTAGTACAGCAGCATGGAGG + Intronic
1080262508 11:30364758-30364780 GTGCCAATCCAGCACCATTAGGG - Intergenic
1080587416 11:33694558-33694580 GTGGCAGGGCAGGACCATTGGGG - Intergenic
1083965748 11:66042716-66042738 GTGGCAGCCCAGCCGCAAGGTGG - Exonic
1085026486 11:73239536-73239558 GTGGCTGCAGAGCACCATGGTGG - Intergenic
1087328625 11:96753223-96753245 GTGGCTGTCCCTCTCCATGGGGG + Intergenic
1087383288 11:97436605-97436627 GTGGAAGCCCAGCAAGATGGAGG + Intergenic
1089182201 11:116590768-116590790 GTGGCACTCAAGGCCCATGGTGG + Intergenic
1089760616 11:120720422-120720444 CTTGCAGTCCAGCACCTTTGGGG + Intronic
1090767764 11:129891641-129891663 TTGGCAGTGGAGTACCATGGAGG - Intronic
1091676327 12:2493341-2493363 GTTCCAGTGCATCACCATGGAGG + Exonic
1091676779 12:2496977-2496999 GAGGCAGTGAAGCACCAAGGAGG + Intronic
1092637721 12:10469367-10469389 ATGGCAGTGCAGCACGCTGGAGG + Intergenic
1093633495 12:21437715-21437737 CTGGGAGTCCGGCAGCATGGAGG + Exonic
1099309324 12:80998156-80998178 GTGACAGGCCTGCACCAAGGAGG - Intronic
1101876965 12:108602532-108602554 GTGGCAGTGCAGCACCTTCCAGG + Intergenic
1105255701 13:18743001-18743023 GGGGCAATCCAGAGCCATGGGGG - Intergenic
1116785571 14:49284568-49284590 GTGGCAGTCAAGGACAGTGGGGG - Intergenic
1118601269 14:67472791-67472813 GTGGGAATCCAGCACCACGGGGG + Exonic
1119419462 14:74499778-74499800 CTGGGAGTTCAGAACCATGGTGG - Exonic
1119553270 14:75533137-75533159 TTGGGAGTCCAGCTCCATGCTGG + Intronic
1122307908 14:100777112-100777134 CTGGCAGGGCAGCAGCATGGAGG + Intergenic
1122612550 14:102995577-102995599 GTGGCAGACCAGGACCCTGTGGG - Intronic
1125143721 15:36440812-36440834 GTGGCAGTCCTGGACCTGGGAGG + Intergenic
1125766992 15:42142565-42142587 GGGGAAGTGCAGCACAATGGGGG + Exonic
1127632308 15:60838475-60838497 GTGGCAGCCCTGCACCACAGAGG - Intronic
1128818364 15:70630378-70630400 CTGGCAGCCCAGGACAATGGAGG + Intergenic
1128982724 15:72198547-72198569 TTGGCACTACAGCATCATGGTGG + Intergenic
1129235994 15:74224120-74224142 GGTGCAGACCGGCACCATGGCGG + Intergenic
1129689009 15:77702641-77702663 GTTGCAGACCGGCCCCATGGTGG + Intronic
1129816329 15:78557642-78557664 GTGGCAGTCATGCAGGATGGAGG - Intergenic
1131057662 15:89385201-89385223 GTGACAGACCAGCAAGATGGGGG - Intergenic
1132544048 16:524918-524940 CTGGCAGTCCAGTAACCTGGAGG + Intergenic
1132627677 16:899489-899511 GTGGCTGCCCAGGACCAGGGCGG + Intronic
1133019876 16:2962736-2962758 GGGGCAGGCCTGCACAATGGCGG - Intergenic
1133317156 16:4892008-4892030 GTGGCAGACAGGCAGCATGGAGG - Intronic
1133804804 16:9116932-9116954 GTGGCTTTCAAGCAGCATGGTGG - Exonic
1134047000 16:11108368-11108390 AAGGCAGTCCAGGAGCATGGAGG + Intronic
1135743356 16:24995624-24995646 GCGGCAATCCACCACCAGGGTGG + Intronic
1136402587 16:30026621-30026643 GAAGCACACCAGCACCATGGCGG + Exonic
1139668477 16:68474847-68474869 GTTGCATTCAAGCACCATGAGGG - Intergenic
1140687522 16:77447913-77447935 GTTTCACTCCAGCTCCATGGTGG - Intergenic
1142069376 16:88082628-88082650 GTAAAAGGCCAGCACCATGGAGG + Intronic
1144705983 17:17368136-17368158 TTGGCCGTCCAGCACCACGTGGG - Intergenic
1144834433 17:18149516-18149538 GTAGCAGTCCAGCCCCTTGTGGG - Exonic
1145816795 17:27800774-27800796 GTGGCAGTTCATCAGCAGGGTGG + Intronic
1149468764 17:56899633-56899655 GTGGCGGTGCAGCCCCATTGTGG - Intronic
1151666759 17:75549675-75549697 GAGGCTGCCCAGCACCTTGGGGG - Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156968825 18:43130333-43130355 GGGGCAGCCCTGCACCGTGGTGG - Intergenic
1157887534 18:51383377-51383399 GTGGCCTTCCAGAACCAAGGGGG + Intergenic
1160763036 19:795404-795426 GTGGCCGCCGAGCTCCATGGAGG - Intergenic
1161058502 19:2202316-2202338 GTTGCAGTCCAGCCCCGTGCTGG + Intronic
1162786701 19:13039548-13039570 GAGGCAGTGCATCCCCATGGTGG + Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
925498753 2:4481411-4481433 ATGGAAATCCAGCACCATGTTGG - Intergenic
930243533 2:48960101-48960123 GTGGCAGTTCAGTCCCATAGTGG - Intergenic
931244402 2:60480360-60480382 CTGACTGTCCAGCACCATGCTGG + Intronic
937475724 2:122213567-122213589 TTGGTAGTCCAGCTCCATGTTGG + Intergenic
937862415 2:126721337-126721359 GAGGGAGTTCAGGACCATGGGGG + Intergenic
941919059 2:170831049-170831071 ATGAAAGTCCAGCACCTTGGTGG - Exonic
944676349 2:202036092-202036114 GTAGCAGGCCAGGACGATGGTGG - Exonic
947219816 2:227781479-227781501 GTGGCCGTCCAGCACTTGGGAGG - Intergenic
1168819844 20:765466-765488 GTGGCCGTCCAGCACCCAGGAGG + Exonic
1170734078 20:18998661-18998683 GTGGCCTTCCAGCACTTTGGAGG - Intergenic
1171810636 20:29742736-29742758 GCGGCCTTCCAGCACCAAGGCGG + Intergenic
1171880497 20:30614805-30614827 GTGGCAATCCATAGCCATGGGGG - Intergenic
1171896251 20:30812950-30812972 GTGGAAGACCAGCATCATGTCGG + Intergenic
1175908417 20:62393087-62393109 CTGGCAGGCCAGCGCCATGGCGG + Intronic
1176841720 21:13848031-13848053 GGGGCAATCCAGAGCCATGGGGG - Intergenic
1180193845 21:46182143-46182165 GAGCCAGGCCAGCCCCATGGTGG - Intronic
1181333799 22:22115134-22115156 GCGGCAGTGCAGCACCACCGCGG + Intergenic
1183942826 22:41305755-41305777 GTGCCGGCCCAGCACCCTGGAGG + Intronic
1184032947 22:41905479-41905501 GCGGCAGGCCAGCAGGATGGCGG - Exonic
1184271573 22:43387454-43387476 GAGGACATCCAGCACCATGGAGG + Intergenic
950313380 3:11978593-11978615 GGTGCAGACCAGCATCATGGAGG + Intergenic
952391139 3:32881510-32881532 GTGGCAGTCAGTCAGCATGGTGG - Intronic
952445056 3:33373042-33373064 GTGGCTGTCCAGCAACTTGCAGG + Intronic
952655702 3:35782855-35782877 CTGGCAGTGAAGCACCATGCTGG - Intronic
954858414 3:53666490-53666512 GTTTCAGTGCATCACCATGGAGG + Exonic
955500544 3:59578634-59578656 GTGCCAGACTAGTACCATGGAGG - Intergenic
960277715 3:115746185-115746207 CTGGTAGTACAGCAGCATGGAGG - Intergenic
962381861 3:134904493-134904515 GTGGCAGGTAAGCACCATGGGGG + Intronic
963266582 3:143245911-143245933 GGTTCAGTCCTGCACCATGGCGG + Intergenic
963736172 3:149019887-149019909 GTGGCGGTCCAGAGCCATGCTGG + Intronic
965901397 3:173645326-173645348 GTGGGAATCCAGCACTACGGGGG - Intronic
968477378 4:818355-818377 GTGGCAGTCGAGGCCCGTGGCGG - Intronic
968764031 4:2458907-2458929 GTGGCAGCCCAGCACCCGAGTGG - Intronic
978371508 4:108034037-108034059 GTGGCAGTGCAGCAGCTTTGGGG + Intronic
978686325 4:111448769-111448791 GTGGCAGTCCTGCATCAAGCAGG - Intergenic
978721737 4:111917970-111917992 GTGGTCTACCAGCACCATGGAGG + Intergenic
979093948 4:116520399-116520421 GTGGCCTGCCAGCACCAAGGAGG + Intergenic
981730533 4:147892554-147892576 GTGGGAGTTGAGCAGCATGGGGG + Intronic
983666631 4:170190944-170190966 CTGGTAGTACAGCAGCATGGAGG + Intergenic
983925813 4:173400835-173400857 GGGGCAGTACAGCATAATGGTGG - Intronic
986042827 5:4010522-4010544 ATGTCAGTACAGCACCTTGGGGG + Intergenic
986224672 5:5801593-5801615 GTGGCAGCCACGCACCAAGGAGG + Intergenic
986915404 5:12613546-12613568 GTGGCTGCCCATCCCCATGGTGG + Intergenic
999630969 5:153571100-153571122 GGGGCTGTCCTGCACAATGGAGG + Intronic
1002396388 5:178959231-178959253 GTGACAGTGCAGTACAATGGGGG - Intronic
1003396152 6:5753825-5753847 GTGGCAGTCCAGCACCATGGTGG + Intronic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1010274035 6:73948568-73948590 GTGGCAGGGCAGCAGCATGAGGG - Intergenic
1010793812 6:80095897-80095919 GTGAAAGAACAGCACCATGGGGG + Intergenic
1013137820 6:107299597-107299619 CTGGTAGTACAGCAGCATGGAGG - Intronic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1015760171 6:136650073-136650095 GTGGAAAGCAAGCACCATGGAGG + Intronic
1016275655 6:142349384-142349406 GGGGCATTCCAGCTACATGGGGG - Intronic
1018043926 6:159949826-159949848 ATTGCAGTCCAGCAGCCTGGTGG - Intergenic
1019525041 7:1477049-1477071 GCGGCCCTCCAGCACCATGACGG - Intronic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1022285573 7:28954050-28954072 TTGGCAGTGGAGTACCATGGAGG - Exonic
1024218279 7:47266409-47266431 GGGGCAGTCCTGCCCCCTGGTGG - Intergenic
1029064845 7:97839155-97839177 GTTGCAGTCTAGCAAAATGGGGG - Intergenic
1034889585 7:154827980-154828002 GTTCCAGTCCAGCACCACGCAGG - Intronic
1035141612 7:156768486-156768508 GTGGCAGCCCATCACAATGGAGG - Intronic
1035289900 7:157831249-157831271 GGGACAGGCCTGCACCATGGGGG - Intronic
1038439941 8:27564776-27564798 TTGGCAGGCGTGCACCATGGGGG - Intergenic
1038795605 8:30706672-30706694 GTGACATCCCAGCACTATGGGGG + Intronic
1039058983 8:33558567-33558589 GTGGGAGTCCAGCAGGAGGGAGG - Intronic
1044299248 8:90564715-90564737 TTGCCAGTCCAGCACAGTGGAGG - Intergenic
1045800106 8:106092404-106092426 GTGGTAGTCCAGCCCCATGAAGG + Intergenic
1045976327 8:108133798-108133820 CTGGCAGTGCAGCACCGTGGTGG - Intergenic
1046724865 8:117663303-117663325 CTGGAAGTACAGCACCTTGGTGG + Intergenic
1048266924 8:132995487-132995509 AAGTGAGTCCAGCACCATGGAGG - Intronic
1049591876 8:143466387-143466409 GCTGCAGGCCAGCACCGTGGAGG + Intronic
1052030227 9:23620087-23620109 GTGACTGTCCAGCACCATGGGGG + Intergenic
1052881411 9:33602956-33602978 GGGGCAATCCAGAGCCATGGGGG + Intergenic
1053494907 9:38542889-38542911 GGGGCAATCCAGAGCCATGGGGG - Exonic
1054810897 9:69433111-69433133 GTGGAGTTCCAGCCCCATGGTGG - Intronic
1056999170 9:91491821-91491843 GGGGCTGTCCAGCACCGTGCAGG - Intergenic
1060211027 9:121710496-121710518 GTGGGAGCCCAGAACCCTGGGGG - Intronic
1060417255 9:123440235-123440257 TTGGCAGTGCAGCTCCATGGAGG - Intronic
1062067017 9:134534016-134534038 GTGGCCGTGCAGCTGCATGGAGG + Intergenic
1062117163 9:134815661-134815683 GAGGCAGGCCAGCACTGTGGGGG - Intronic
1062289134 9:135786753-135786775 GTGGCCTCCCAGCACCAGGGTGG - Intronic
1062645063 9:137543662-137543684 TGGGGAGGCCAGCACCATGGGGG + Intronic
1062702900 9:137917386-137917408 GTTCCAGTGCATCACCATGGAGG + Exonic
1187686650 X:21822075-21822097 GTGGCATTCCATCAGCTTGGTGG + Intergenic
1188385043 X:29546084-29546106 GTGGCTGTCCTGCACATTGGAGG - Intronic
1189182162 X:39014897-39014919 GTGCCAGTCCAGCAGCATGCTGG + Intergenic
1192090964 X:68155434-68155456 GTGGCAGGAGAGCAGCATGGGGG - Intronic
1195239546 X:102937479-102937501 CTGGCCGTCCAGCAGGATGGTGG - Exonic
1195298162 X:103500574-103500596 CTGGCCGTCCAGCAGGATGGTGG + Exonic
1197785892 X:130196641-130196663 GTGGCAATCCATCAACATTGTGG - Intergenic
1200093126 X:153644927-153644949 GTGGCTGTCCAGCTCCCTGCTGG + Intronic
1201065361 Y:10090760-10090782 GCAGCAGGGCAGCACCATGGCGG - Intergenic