ID: 1003397250

View in Genome Browser
Species Human (GRCh38)
Location 6:5763952-5763974
Sequence CAGAGTCCAAACTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003397245_1003397250 -5 Left 1003397245 6:5763934-5763956 CCATCCTCAGTCCAAAGTCAGAG 0: 1
1: 0
2: 0
3: 41
4: 346
Right 1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 211
1003397243_1003397250 15 Left 1003397243 6:5763914-5763936 CCAGGGGAAGGAATCTCTTCCCA 0: 1
1: 0
2: 3
3: 52
4: 267
Right 1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 211
1003397244_1003397250 -4 Left 1003397244 6:5763933-5763955 CCCATCCTCAGTCCAAAGTCAGA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 211
1003397246_1003397250 -9 Left 1003397246 6:5763938-5763960 CCTCAGTCCAAAGTCAGAGTCCA 0: 1
1: 2
2: 0
3: 13
4: 231
Right 1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 211
1003397242_1003397250 22 Left 1003397242 6:5763907-5763929 CCGTGCTCCAGGGGAAGGAATCT 0: 1
1: 0
2: 3
3: 24
4: 341
Right 1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003397250 Original CRISPR CAGAGTCCAAACTCTGAGGA GGG Intronic
900359081 1:2279308-2279330 CAGAGACCACCCTCTGATGACGG + Intronic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
905753769 1:40489454-40489476 AAGACTCAAAATTCTGAGGATGG + Intronic
907913201 1:58845060-58845082 CAGATACCCAAATCTGAGGATGG + Intergenic
910941282 1:92537482-92537504 TACTGACCAAACTCTGAGGATGG - Intronic
916719977 1:167477474-167477496 CAGAGTCCAAGCCCACAGGAGGG - Intronic
918211862 1:182358320-182358342 CAGGGTCTAAACTCTTATGAGGG + Intergenic
919274639 1:195397783-195397805 GAGTGTCCAAACTCTAAGAACGG + Intergenic
923066907 1:230526771-230526793 CAGCGTTCAAACTCTGATAAGGG - Intergenic
1063679191 10:8171007-8171029 GTGAGTCCAAAATCTGATGATGG + Intergenic
1066086082 10:31973092-31973114 CAGATGCCAAACTTTGAGGCTGG - Intergenic
1066300508 10:34091675-34091697 CAGAATCTACATTCTGAGGATGG + Intergenic
1067053472 10:43038360-43038382 AAGCATCCACACTCTGAGGAGGG + Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1069557532 10:69407778-69407800 CAGGGGCCAGGCTCTGAGGAGGG - Intronic
1070961325 10:80502146-80502168 CAGTGTCCAGGCTCTGAGGCAGG + Intronic
1072106029 10:92274952-92274974 CACAGTTCAAAATCTGAGGAGGG - Intronic
1073644157 10:105282524-105282546 CAGATTCCTAACTGGGAGGAAGG - Intergenic
1076403908 10:130200296-130200318 GGGAGGCCAAACTCTGAGGGAGG - Intergenic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1078525286 11:12096326-12096348 CAGAGTCCAAAATGGGAGGCAGG + Intronic
1078904950 11:15675269-15675291 CAAAGTGCAAAAGCTGAGGAGGG + Intergenic
1080068945 11:28055548-28055570 CAGAGTCCCAACTCAAAGCAAGG - Intronic
1080273978 11:30482888-30482910 CAGAGTTCAAACTCTGTAGAAGG + Intronic
1080298690 11:30759448-30759470 CAGAGTTGAAACTTTCAGGAAGG + Intergenic
1083531617 11:63428442-63428464 CAGAGTTCAAGCTCTGATAATGG + Intergenic
1083994597 11:66265844-66265866 CGGGGTCCAAACCCTGAGGGAGG - Exonic
1084951412 11:72668108-72668130 CAAAGTCCAAACTCTCAGCCTGG + Intronic
1085068432 11:73519419-73519441 TAGAGTGTAAACTCTGAGGATGG - Intronic
1085740905 11:79077693-79077715 GAGAGTTCAGACTCTGGGGAGGG + Intronic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1087326312 11:96727630-96727652 CAGCGTTCAAACTCTGATAATGG - Intergenic
1090415579 11:126538055-126538077 CAGAGTCCCAAGGCTGAGAATGG + Intronic
1091022944 11:132117339-132117361 CAGACTGGAAACTCTGAGCATGG + Intronic
1092013595 12:5138232-5138254 CAGAGTCCTGACTCTGGAGATGG + Intergenic
1094516778 12:31136750-31136772 CAGAGTCCAAGGTCTGAATAAGG - Intergenic
1096226226 12:49868460-49868482 CAGAGTGCAAAATCTGGCGAGGG + Exonic
1096874374 12:54615714-54615736 CAGAGTCCACAGTCAGAGGATGG + Intergenic
1097749625 12:63337529-63337551 CAGCGTTCAAGCTCTGAGAATGG + Intergenic
1099424987 12:82512751-82512773 CACACTCCAAACTCTCAGGAAGG + Intergenic
1101305127 12:103520447-103520469 GAGAGTCCCAAGTCAGAGGATGG + Intergenic
1103458683 12:121087079-121087101 CAGAGTCACAACACTAAGGAGGG + Intergenic
1103741319 12:123093683-123093705 CCTATCCCAAACTCTGAGGATGG + Intronic
1103777794 12:123379401-123379423 GGGACTCAAAACTCTGAGGAGGG + Intergenic
1104621255 12:130314477-130314499 CAGACCCGAAACTTTGAGGATGG + Intergenic
1107194021 13:37625511-37625533 CAGAGTCAAAACTCTGATTTGGG + Intergenic
1108896382 13:55334276-55334298 CAGTGTCCCAAGGCTGAGGAGGG - Intergenic
1109466914 13:62746534-62746556 CAGATACCAAAATCTGAGTATGG - Intergenic
1110214259 13:73009061-73009083 CAGATGCCACACTCTAAGGATGG - Intronic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1113612504 13:111657140-111657162 CAGAGGTGAAACTATGAGGAAGG - Intronic
1113907549 13:113826814-113826836 CAGAGGCCCACCTCTCAGGATGG - Intronic
1117297884 14:54395643-54395665 GAGAGTCCAAAATCTGATGGGGG - Intergenic
1117752952 14:58942700-58942722 CAGAGTGCAAACACAGAGCAGGG - Intergenic
1118534618 14:66746860-66746882 AGGAGTCAAAACTCTGAGGGAGG - Intronic
1120076323 14:80162872-80162894 CAACATCCAAACTCTGAGAAGGG - Intergenic
1126496124 15:49292516-49292538 CTGAGTCCAAACACTCAAGATGG + Exonic
1127361561 15:58248812-58248834 CAGATTCTAAACTCTAAGAATGG + Intronic
1128607501 15:69047711-69047733 CAGAGCCCACTCTATGAGGAAGG - Intronic
1128782249 15:70368349-70368371 CAGTGTTCAAGCTCTGAGAACGG + Intergenic
1129023800 15:72549456-72549478 CAGAGTTGAAATTGTGAGGAAGG + Intronic
1131017223 15:89067816-89067838 GAGAGTCCAAACCTTGAGGTAGG + Intergenic
1131666619 15:94577679-94577701 CAGAGTCCAAGCTCTCTGGGTGG - Intergenic
1132035946 15:98484853-98484875 CACAGTCCAAACTCTCAGTTGGG + Intronic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1134089438 16:11383805-11383827 CACTGTCCACACCCTGAGGAGGG + Intronic
1134141080 16:11719962-11719984 CAAAGGCCACAGTCTGAGGAAGG + Intronic
1135063309 16:19289119-19289141 CAGAGTCCAAGCTCTGAAGTTGG + Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1137461474 16:48668121-48668143 CAGCGTTCAAGCTCTGAGAATGG - Intergenic
1139438127 16:66948565-66948587 CCCAGTCCAAACTCCGAGGCTGG + Intergenic
1140772801 16:78221626-78221648 CAGATACCAAAATATGAGGAAGG - Intronic
1141825323 16:86475007-86475029 CAGAGTCCAGAGGCTGAGGCAGG - Intergenic
1142332651 16:89464774-89464796 CAGAGACCAAACTCTACAGAAGG + Intronic
1144763561 17:17721013-17721035 CAGATTCCAGATTCTGGGGATGG - Intronic
1146596938 17:34177457-34177479 CAAAATCCAAGGTCTGAGGAAGG - Intergenic
1147177703 17:38666667-38666689 GAGAGTCCACACCCTAAGGAGGG + Intergenic
1147438520 17:40432416-40432438 CTGAGTCCAAAGTCCGAGGCAGG - Intergenic
1151345976 17:73501418-73501440 CAGTGTCCACACCTTGAGGAGGG + Intronic
1152914840 17:83028656-83028678 CAGAGCCCACACTCTGCTGACGG + Intronic
1154284719 18:13041980-13042002 CAGAGTCCAAACTTTGAAGGAGG - Intronic
1155740269 18:29280591-29280613 CACTGTCCAATCCCTGAGGAGGG + Intergenic
1155909397 18:31490684-31490706 CATAGTCCAAAGTGTGAGGTGGG + Intergenic
1156447823 18:37250091-37250113 CAGAGGCCAATCTCTGAGCTGGG + Intronic
1156828755 18:41465607-41465629 CAAAGTCCAAACACTCAGCAGGG - Intergenic
1157583251 18:48785605-48785627 CAGAGACCAAACCCAGGGGAAGG + Intronic
1158042996 18:53119431-53119453 CAGAGTCTAATATGTGAGGATGG - Intronic
1158154487 18:54409910-54409932 AAGAGTCCAAACTCTGGAGCTGG - Intergenic
1158447473 18:57533691-57533713 CGGAGTTCAAACTCACAGGAAGG - Intergenic
1159624393 18:70675344-70675366 CAGAGACCAAAACCTGAGAATGG + Intergenic
1159912406 18:74158869-74158891 CAGATTCCAAAGTATGCGGAGGG - Exonic
1160855313 19:1214688-1214710 CACAGTCCTAACCCTGAGGAGGG - Intronic
1163347375 19:16752071-16752093 CAGAGGACAAACTCAGAGGAGGG - Intronic
1167359890 19:49024377-49024399 CACAGTCCAACCTCCCAGGAGGG + Intronic
1167363671 19:49043782-49043804 CACAGTCCAACCTCCCAGGAGGG - Intergenic
1167364826 19:49049145-49049167 CACAGTCCAACCTCCCAGGAGGG + Intergenic
1167765556 19:51479965-51479987 TACAGTCCAAACTCTTAGGTGGG - Intronic
926579026 2:14614558-14614580 CATAGTTCAATCTCTGAGGGAGG + Intergenic
926690590 2:15730733-15730755 CAGAGTCTGACCTGTGAGGAGGG + Intronic
926954008 2:18273375-18273397 CAGAATGCAAATTCAGAGGAAGG - Intronic
929726678 2:44436676-44436698 CACAGTCCTAAATCTGAGGTTGG - Intronic
930407497 2:50978240-50978262 CAGAGACCATACTCTGAATATGG + Intronic
931227369 2:60343095-60343117 CAGATCCCAAACTCTGCTGAAGG + Intergenic
932892984 2:75612013-75612035 CAGGGTCCCAACTCTGTGCAGGG - Intergenic
934166396 2:89297904-89297926 CAGTGTCCCAAGTCAGAGGAGGG + Intergenic
934200880 2:89884552-89884574 CAGTGTCCCAAGTCAGAGGAGGG - Intergenic
936077585 2:109411530-109411552 CAGAGACCAGATTCAGAGGATGG + Intronic
938109273 2:128553210-128553232 CAGGGACCAGAATCTGAGGAGGG - Intergenic
938874991 2:135522827-135522849 AAAAGTCCAAACTCTTAGCATGG - Intronic
939364310 2:141212734-141212756 AAAATACCAAACTCTGAGGAAGG + Intronic
939587413 2:144021999-144022021 CAGAGTGTAGCCTCTGAGGAAGG + Intronic
940063534 2:149599797-149599819 CAGAGTCCAAAAGCTGAGAAGGG + Intergenic
940140154 2:150485089-150485111 CAGACTCGAAACTCTGGAGAAGG - Intronic
941155275 2:161970037-161970059 CTGAATCAAAACTCTGGGGATGG + Intronic
942884498 2:180906830-180906852 CAGAGAACCAACGCTGAGGATGG - Intergenic
946419913 2:219558889-219558911 CAGAGTTTAAACTCTGGTGAGGG - Intronic
946531468 2:220575297-220575319 AAAAGTACAAACTCTGAAGAAGG - Intergenic
947440561 2:230117591-230117613 CAGCGTTCAAGCTCTGAGAACGG - Intergenic
948717844 2:239876796-239876818 CAGAGTCTAACATCTGAGGAGGG + Intergenic
948744142 2:240073766-240073788 GAAAGTCAACACTCTGAGGAGGG - Intergenic
1170932740 20:20783441-20783463 CAGAGGCTAAAAACTGAGGATGG - Intergenic
1171247149 20:23620815-23620837 CAGTGTTCAAGCTCTGAGAATGG - Intergenic
1173095933 20:40028245-40028267 CAGAATCCAGACTATGAGGCTGG - Intergenic
1174467477 20:50729367-50729389 CAGAGACCACACTCTGATCATGG - Intergenic
1174783114 20:53408208-53408230 CAGACTCCAAACTTGGAGAACGG - Intronic
1176238677 20:64065925-64065947 CTGAGGCCAAACTCTCATGAAGG - Intronic
1176377922 21:6095932-6095954 CAGAGTCCAGACTCTAAGGAGGG - Intergenic
1179745552 21:43442316-43442338 CAGAGTCCAGACTCTAAGGAGGG + Intergenic
1180170635 21:46056493-46056515 CTCAGTCCTAACTTTGAGGAGGG + Intergenic
1184508644 22:44918979-44919001 CAGAGTCAAAGCACTGAGGGAGG - Intronic
949300882 3:2582574-2582596 GAGAGTTCACTCTCTGAGGAAGG - Intronic
949589611 3:5480421-5480443 CTGAGTCAAAAGTCTGAGGTGGG - Intergenic
950746536 3:15094614-15094636 CAGAGCCAAAACTATTAGGAGGG - Intronic
955184583 3:56702868-56702890 CAGAGTTCAAAGACTGCGGAAGG + Intergenic
955267990 3:57466485-57466507 CAGAGTGCAAACTCTGTGATTGG - Intronic
955295471 3:57730666-57730688 TAGAGCCCACACTCTGAAGATGG - Intergenic
957156435 3:76550828-76550850 CAGTGACCAAAGTCTGAAGAAGG - Intronic
957276649 3:78098278-78098300 CAGTGTCGAAAGTCAGAGGAAGG - Intergenic
959476712 3:106821197-106821219 CAGTGTCCAAAGTCTGGGGGCGG - Intergenic
961175609 3:124832612-124832634 CAGAGAACAGACTCTGTGGAAGG - Intronic
961676431 3:128569851-128569873 CAGGGTCCATAATCTGGGGAGGG + Intergenic
961904866 3:130252492-130252514 CAGCTTCCAAACTGTGGGGAAGG + Intergenic
962591705 3:136896300-136896322 CAGACACCAAAATCTGAGAAGGG - Intronic
964097273 3:152946872-152946894 CAAAGTCTAAACTGTAAGGAGGG - Intergenic
964569148 3:158094236-158094258 CAGTGTCCAAACTCTGGGGCAGG - Intergenic
965267983 3:166572099-166572121 CAGAGTTCAAGGTCTGAGTATGG + Intergenic
965548081 3:169935580-169935602 CAAAGTCTAAAGTTTGAGGAGGG + Intronic
966081313 3:176005233-176005255 AAGATTCTAAACTCTGAAGAGGG + Intergenic
967675521 3:192294277-192294299 CAGAGTCCTTACTTGGAGGAAGG + Intronic
971021167 4:22537265-22537287 CAGTGTCCAAGCTGTGAGGGAGG - Intergenic
974877646 4:67717643-67717665 CAGAAACCACACTCGGAGGAGGG - Intergenic
976438357 4:85044281-85044303 CAGAGTTCAAGCTCTGATAAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976977238 4:91180284-91180306 CAGAGTCTGAAATCTGAGAATGG - Intronic
977267313 4:94870819-94870841 GAAACTCCAAACTCTGAGGCAGG - Intronic
980335882 4:131472834-131472856 CAGAATTCAAACTCAGAGAATGG - Intergenic
984490266 4:180425476-180425498 CAGAGTTTAAGCACTGAGGAAGG + Intergenic
985166162 4:187096900-187096922 AAAACTCAAAACTCTGAGGAGGG - Intergenic
990668968 5:58105647-58105669 TAGAGTTCAAGCTCTGATGAGGG - Intergenic
991128186 5:63090923-63090945 CAGAGTTCAAACACTGTGCAGGG - Intergenic
993778000 5:92026082-92026104 GAGAGTCTATAATCTGAGGAAGG + Intergenic
994090267 5:95803553-95803575 CAGAGTGCTAACTCTGTGCAAGG - Intronic
996120458 5:119666009-119666031 AAGATTCAAAACTCAGAGGAGGG + Intergenic
997362900 5:133306372-133306394 CAGAGCACTTACTCTGAGGAGGG + Intronic
999279622 5:150356772-150356794 CAAAGTCCAAACTCTGTTGGGGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1000574401 5:162958877-162958899 CAGATACCAAAATCTGTGGATGG - Intergenic
1002282811 5:178142842-178142864 CAGAGTCGAAGTTCTGACGAAGG - Exonic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1005731053 6:28697140-28697162 TTGATTTCAAACTCTGAGGAGGG + Intergenic
1007585923 6:42989414-42989436 CAGATTCTAAACTCTTTGGAGGG + Intronic
1007728639 6:43932353-43932375 CAGAGTCCATACTCTAGGGTGGG + Intergenic
1007816966 6:44531495-44531517 CAGAGTGAAACCTCTGATGAAGG - Intergenic
1008662359 6:53681433-53681455 TAGTGTCTGAACTCTGAGGATGG + Intergenic
1012598024 6:101062648-101062670 CAGTGTCCGAGCTCTGAGAATGG + Intergenic
1013709221 6:112877555-112877577 GAGATTCCAAGCTCTTAGGAGGG - Intergenic
1014352610 6:120363270-120363292 CAGCGTTCAAGCTCTGATGAGGG - Intergenic
1018668505 6:166161374-166161396 CAGAGGCTAGACTCTGAGGCAGG - Intronic
1019131740 6:169882071-169882093 CAGAGACCAAGCTCAGATGAGGG + Intergenic
1021327791 7:19296194-19296216 CAGAGGCCTAACTCTGTGTATGG - Intergenic
1022889128 7:34677747-34677769 CAGAGTCCATCCACTGAGGCTGG + Intronic
1023794743 7:43782454-43782476 CAGAGTACAACCTGTCAGGAAGG + Intronic
1024604713 7:51014032-51014054 CAGAGGCCACACTGTTAGGACGG + Intergenic
1024659898 7:51483527-51483549 CCAAGTCCCAACTCAGAGGAAGG - Intergenic
1024752323 7:52482039-52482061 CAGAGTCAAAATTCTGAGTGAGG + Intergenic
1024786922 7:52918514-52918536 TAGAGCCAAAACTCTAAGGAAGG - Intergenic
1024792443 7:52982501-52982523 TGGAGTCCAAAGTCTGAGGGAGG + Intergenic
1024832575 7:53478777-53478799 CAGATTCTAAGTTCTGAGGAAGG + Intergenic
1024839971 7:53574610-53574632 CCTAGTCAGAACTCTGAGGAGGG + Intergenic
1024991013 7:55234537-55234559 CAGAGTCCAACCCATCAGGAAGG + Intronic
1025986332 7:66455734-66455756 CAGGAGCCAAACTCTGAGGCAGG + Intergenic
1025994094 7:66517351-66517373 CAAAGGCCAAACTCTCAGGGAGG - Intergenic
1026028598 7:66768928-66768950 CAGGAGCCAAACTCTGAGGCAGG - Intronic
1026985707 7:74554051-74554073 CAAAGGCCAAACTCTCAGGGAGG - Intronic
1027972064 7:85096852-85096874 CAAAGTCCAAAGTCCTAGGATGG + Intronic
1031158812 7:118142147-118142169 CCGAGTTGAAACTCTGAGCATGG - Intergenic
1031979806 7:128117157-128117179 CAGATTACACACTCTGGGGATGG - Intergenic
1033762543 7:144451358-144451380 CAGATACCAAAATCTGTGGATGG + Intergenic
1033764730 7:144476169-144476191 CATAGTCAGAACTCTGAGGACGG + Intronic
1034428406 7:151027308-151027330 CAGACACAAAACACTGAGGAAGG + Intergenic
1035373219 7:158392187-158392209 CAGAGTCCTCACCCTGAGGATGG - Intronic
1035383953 7:158458157-158458179 CACAGGCCAAGCTCGGAGGATGG - Intronic
1035730240 8:1849421-1849443 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730349 8:1849901-1849923 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730359 8:1849945-1849967 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730369 8:1849989-1850011 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730379 8:1850033-1850055 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730389 8:1850077-1850099 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730399 8:1850121-1850143 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1035730410 8:1850165-1850187 CAGAGGGCAAATGCTGAGGAGGG + Intronic
1036592356 8:10180469-10180491 CACTCTCCAACCTCTGAGGAGGG - Intronic
1043535973 8:81204898-81204920 CAGAGTTCAAGATCTGAGAACGG - Intergenic
1047996598 8:130342552-130342574 CAATTTCCAAACACTGAGGAGGG + Intronic
1048778538 8:137975493-137975515 AAGAGTTGAAACTCTGAAGAAGG + Intergenic
1051096895 9:13476948-13476970 CAGAGAACAAAGTCAGAGGATGG - Intergenic
1051419456 9:16875347-16875369 CCGAGACCATACTTTGAGGATGG - Intergenic
1051590543 9:18772923-18772945 GAGATTCCAAACATTGAGGAGGG + Intronic
1051936911 9:22454254-22454276 CAGACTCCAATGTCTGAGGAAGG + Exonic
1053826632 9:42031559-42031581 CAGAGTCCAAAATGTGTGGCTGG + Intronic
1054603927 9:67155864-67155886 CAGAGTCCAAAATGTGTGGCTGG - Intergenic
1054987494 9:71279663-71279685 CAGAGGACAACCTCTAAGGAAGG + Intronic
1056185814 9:84133915-84133937 CAGTGTCCAAACTGTGCGTAGGG - Intergenic
1058670527 9:107357294-107357316 GAGAATCCAACCTCAGAGGAAGG + Intergenic
1062592359 9:137280117-137280139 CAGACTCCGGACTCTGAGGCGGG - Exonic
1189492613 X:41481802-41481824 CTGAGGCCAAACTCTCAGGGAGG + Intergenic
1189898507 X:45681723-45681745 CAGGATCCAAACTCAGGGGATGG - Intergenic
1193693653 X:84680241-84680263 CTGAGTCCACTCTCTGGGGAGGG + Intergenic
1201670584 Y:16515928-16515950 CAGTGTTCAAGCTCTGAGAAAGG - Intergenic