ID: 1003399288

View in Genome Browser
Species Human (GRCh38)
Location 6:5778718-5778740
Sequence GGCCATGTGGCCCCAACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003399285_1003399288 8 Left 1003399285 6:5778687-5778709 CCTGCAAAGGTCAAAGGGAGAGA No data
Right 1003399288 6:5778718-5778740 GGCCATGTGGCCCCAACTGTTGG No data
1003399283_1003399288 13 Left 1003399283 6:5778682-5778704 CCAGGCCTGCAAAGGTCAAAGGG No data
Right 1003399288 6:5778718-5778740 GGCCATGTGGCCCCAACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003399288 Original CRISPR GGCCATGTGGCCCCAACTGT TGG Intergenic
No off target data available for this crispr